Description :
From Genome Similarity Track
Location :
Scaffold_5540:1- 1146
Sequence
1145 bases(100 bases per row)
CCGACTACATGCACAAGTACAGCGAGGACACGCAGAATCAATACGTTCTCTAGGCCGGCTGTTGAAAAAAGACACGACCTGAGCTAAACGAACATCAGCT
CACCTTCGACTCCGCCAATCAGAGACTGCCCAAGTCCCGATTCTCGTCTTCCAAGAAACGGTCTGCCACACTGCGGCGTCCGCGACACAAGCGACATGTG
CGTTTGGCTGCGTTCTGATGCAGCACCAAAATAGACGAGCGTGCGTCATCTCAAACTAGAGACGCCAGCTACGACCATCTAAAACTAAATATATGGTCCA
TTGCAAGGAGTTCCTTGCCACCGAGTACGCGCATGTGAAGCTTCACGTTCACCACCTTGGCAACAAGACTTTTGCGATCTATCCAGATCATGTCGCTGTG
CACGGCGATGAACTCGCTTCCTTTGCCGCAACGGATGGCGCGTTTGCTTCCCTTCCTCGCGGAGTACAACTTCGTTGACAAAGACAAGCCCTGTCAGCTG
AACGTACTCGTCGGCGCGCTGTCGCACCATCCTGACTTCGAGCAAGTTTACTTGCTTGTCCTCCAAGAAGTTGAGCTGACATCGCTTCCATGATGTTTCG
GGTCGAGTCGTCACTGAGCAACAATTCCCGTGTTGCGTACGCGCGCGGCGATGAATACAAGTCGCTCTTGGCGTACTTAAGTTCGCCAAAATGAAGAGCC
CTCAGCTGTCGACTCATCCAACATTCATCGTTATCGGTCAATGATGATGTGTTGGGATACTTGGTCTCTCTAGGGGAGCCTCAGGTCTTGAAAATACAAA
ATCTCTTTGGGCACTATGACTCGCATCTGGGCAGTCACTTTAGTCGCGAGAAGACCTTTGTTGATGTGGCGCACTTCTTCTGGTGGCTACACCAGTACCA
TTGGGTACGTAACTTCGTGTGCCACGTGCAACCGCTGAGTCTCGCTAGCGTCGCTGTGCAGCCTATCAATTATGTCTATTTGCTGACAATTGGTCTTTCT
CAAGTATGTCTTCCGCCTGGCGAAGGACAAGCACCAATGCACAGAAATTGTTGTGTTCGTCGACCGCTTTAGCGCTTTAGCAAAATGGTTTATCTAGCCC
CAGTACACGCAAGCGCCACTGGCAAACGGTCGAAATGTTCCTCGA