Description :
From Genome Similarity Track
Location :
Scaffold_964:1- 11373
Transcript NameFunction/comments
g15640.t1hypothetical protein

Sequence
11372 bases(100 bases per row)
CTCTTTAGCCCATCGAGCTTTCTCGACACTTTGGTTACTCATTGCCATTCTCCACGAGATTTCCTGTTGTCGGTTCACTTCTCAGGCGCCATGCCAATTG
CGTCAGGTCTGGCCTCCGAATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGGATTGTGCGTCCCACCCATGAACTAGGTAAAACGGAGTGTCCC
TCCGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTCCCAGTCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGA
TTGCATGACCGTCTTCACCGACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGATAGCTCAGGGTCGCTCTTGACCGAGACTGCATCATCTCTGCAAAGGCT
TGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGTCGGATTAGAGTTGGTGCTCCGAATCTTCGGTACACGCTTTCCTCGAAAGCCTGTGCGACCT
TCAGAGCGGTAGTGTCTGACATAGCTTTACCCATGACGAATCCTGTAAACGCGCACTGGAACAGTAATAAAGCTGAATTGCTTCGACGAGACTTCAGGGA
TGGTATGACAAAATCCATCGACACCATCTGGAACAGTCGCTCTGCCAAGACGCTTCCTGGCGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTA
CAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCATATAGTCCGATCCAAAAATAGTCTGCTTTGACTCGGTGGTAGGTTCGACCGATACCTTGGT
GACCATCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTTGTGGGCACCACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCC
CCACCGACAGTTCGTTCCAAGAAAATACAGTACCCTATCCTCGCTAAGTACGAACTTGTCGGCCATCTTCCAAGCATCTCTGGCTGCTCTGTAGCTTAGG
TCTGTTTCCTCACCGCTTTTAGGTTCGACCATCTCAGTTCTTCGTCCTGGGCGGCGGAGATTCGTCGCCGGCGCTCTTCCTGTATAACCACAGGGTCAAC
GTCTTCTACGTTCGGAGCGCCAGGGTCCGCCTCGTTGCTCGATTGCTCGGCTCTCAGCTCGTTCTGAGCTTCGGTGATCACACCATTCGCTTCGTCTCGT
TCAGCAGCATCATTCGGCCCTATCACCGAAGTTTCATCTGCAAACCGGACTCGTTTCTTCCTTGTTTTTGCTTGGTGTCTGGTTGTTGCAGCTAGGTAGT
CTGGTTCGTCCCACACAAAGTCGAAAACAAATTTGTCACGGGAGATTCCATGGGCTACTTGGGCTCGGGCGAAGCTGACTGCCGGTTCCTCTTCGGCTGT
GGTCTGTACTGAGGGTTCATAGATGACCTCTCCGATCCGGTTCAGCTCGACCAATTCTAATTTCCTAGCCTCGGTCGAAGCTATGCTGGATTCTTTGCTG
CTGAGAGCCTCGCTTGCCAACGAATCTGCCGCAGCGTTGAATTCTCGGACCACATGGAAATACTTCACTGACCGCAGCTTGGTCGTGAGTTCTCGGTGAC
GATTCAGTTGTACCATCAGAGACTCCTTTCGACATGCCATCACCCCTAGGGACTGCTGGATTGCGAGTCTCGAGTCTCCAGCGATGACTAAATCCTCGGC
TCCATGTTCGAGCGCAGCCGAGACGCCGTTGTTCATTCCAGCATACTCAGCGAGGTTTACCGTGGTGGTCTCGAGATACGCACTCGCAGCCGTCACTACA
GTCCATTCTGGTAATTTCCACAAAATCCACGAGCAACTGCCATACCCACCGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTAT
AGGGCCTCGATAGGCAGGCATAAAGCAAGTGGGGGTCCATACGAGCAGTTGGTGACCCTTTCGTCGGCGGCGTAACCGGAGCCAACGAGTCTTCCAAGTC
AACGAAGCTTGTGAGGCCAGCTTGTAGAAGCTGAGCAAACGTGCAATCGCGTTCCTTGACTCGGTTGACCACCAGGTGCCACGGGGACAACATTACTGCA
AAGTGGGTCGCGCGACCGAACAGTGTCTTAGACTTGTGCACCCATTCGAGCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTAAGAGT
AGCACACCTTCAACACCAGCAGTAGTGCCAAGACCTCCTTCTCGGCCGGGTGGTAGTTCATCTTGGCGTCCTTGAGGACTCGGCCACAAAATCGGACCGG
GTGCAACTTGTCATCGTGGTATTGCATCAAAGTGGAGCTCAATGCCCACTCATTCGCGAATAATGTGACATGCACCTCCTTGTCCCAGTCAAAGTGCCGG
AGGATCGGTGCCTCTGCAACCTTCTGTTGGAGCGCCGCGAAGCTTCGTTTGGCCGCCGAGAGGCTGCCACTAGGTGTGAAGTCTTCGTCCTTCAACTGAT
ACAGAGCTGCTCCATACACTGCGAAGTCCTGGATGAACCGACTGTAGTAATTCAGTGCACCGAGGAAAAACTGCATCCCCTTTTTCGAAGCAGGGAACGG
CAGCTCGGTCACTGCTTTCAACTTCTTGGTGTCGGCTCAAATACCTTCTGCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTA
CTCGTAAAGCTCACATTAATGCGACATTCGGTGAACCGTTGGAGCAGTCGATCTAGCGTCTCCAAGCACGCGTCGAAAGTCTCGGATCCAAAACAGATGT
CATCGACAAACGACCGTCGGTCGAACACTGGCACCAACGAGGATTCATCCAGTTCCCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACTGATT
CACTGCGTCAAGCGTGACCGAGGACTCTCGGTCGGCCTCGAATTTGGTCGGCCAAGTTGTTGACTCATCGGGTTGTCGCAGTGAAGGGTCGATCACCCCT
GTCCGTGCAACCTCGGCGTGGGCTTCGGCCGTTCGCATAAGCTCCGAGAAGTGGAGCCAGCCGCCTTTGGGTTGGACGAAACCTTACAGAGCATTGTCGA
CCATTCGTTGGTAAATCATCGGTGCGTTCTTCAATCCAGACGGCATGCAGAGTCATTCAAAATGTTCAAGCGCACAGACGAAGGCTGAGACCTTGCGAGC
CCGCATCGTCATCATAATAGCCCAGAAGCCACTGTCTGCGTCAAGCGAGCAGAACCATAGGTAGGCCTCCAGGTCGGTCAACAAGTCATCGACCAACGGC
ATGGCGTACTCCATAATCGCGGTAACCGCATCCACCAACTTGTAGTCGATGCACAACCGAATATCAACTCCATTCTTCTTGAGCACAATTACGATGGGCG
ACGCCCACGGGCTGTTCGAAAACGCCACTAGACGAGCCTTCAGCAAGCCTTTCAGGAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTTCTTCGAGC
TCTCTGTTTGATGTGTGGATGCCCCCGTACGTCAATATTGCACACCACACCGTAGGCCGGTGGTGGCAGAGCATTCCCGCTCGCAATCATGATCTTCTCG
TGTCGTTTCAGTACCGCAACGAGACTCTCTTGTTGACGGGCTGTCGCGCTCGGGTTCTGAACATTTGGTCCTGAATAATCCAGGACGGTTTCCGAGGCTT
CGGTCAGGTCTGGTAAAAACGCCAACTCGTGCGCATAGTCCGTCAACTCGATCTCATTCGCCAAATGTTCGGACGTATCATTATCGGTGTTCTCACCACC
CGAACCATCCCCCGTGGTAATCGCATGCATCACGGCCACGAAGGCAGAGTCCAATTGGGTCTCCGGGTTATCACCGAGGACTGGTGTGGACTCCACTTCA
CTCGTCCACGGGGTATCCGCACCGTCTGAGGTGTCGGTCGCCACTGAGTCGGCATCCTCACCGTCCACACTACCTCCGGCGGGCTCGTCAGAGGATCGCA
TCGTAGTCGTCGGCGGTGATCAGTGATCGGTCCTGTCCTGTTGGATCCTTGATACCCCTATCCGCAAATGTTATCTGGCCCTCGTTTCGGCCTCCCAAGT
CGTCAGGTGGTCGAGGAAGGATGCCGCGAGGCGTCGGATAGTCTCGTCGCTCTACCACAGGTGGTTGGTCTGCCAACCATCGTTCGTAGAGTTTGCATTC
CCGCGCGAACAAAGTCTCGTCTCGACACTCTGCGTACGCCAGGACTTGCCACTCCTCATACGTGGAGGAGTTCAAACGAGTGTATCCATATCCTTGTGGC
AAGTCACCCTTTTTCACCCACAGCAATACTGATTTGTGTCTCGCGCAGAAAGCAATCCGTGGTGATACGTTTGTTAGTCGCACCATCGTCGGCTGCCCCC
GTCGAGACCTCATTACAGTGGGCACCAATTTTCCAATCCTGCGGGCCCACACGTCATGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCG
CCATTCCCGCCCAGGGACCGACAAATCTTCGGTCGGGCGTCCAGTCACTTGCATGCTGTACGGCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGGC
ACCATTACCTCGTCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACCGGACTCCGGCTGGAATCATGAAATCTGTTCCCAGGACTACATCGACTCCTG
CACTGTGATCCATAATCCATACTTCAAATTCGTACACGCGTTCCCAGCCTAGCGTGACTTTAACGAGTGCTCGTCTGCGGGTCTCCATCACCCCTGGGTT
AATTCCTCGCACTTCCAGACTCCTACCGTGGTCTGGAACTTCGCGCAAGCGTAACCGTTTCGCATATGACGCGGAAATCACACTGACATTCGCTCCAGTG
TCCAGTAGAATCCTCGTTCGCGAGTCGTTTACAGCCCCATTGACGAGGGCTCGCAATCGCTTCCTCGCTGGGATGACCACCACCCCATTCTCTCGCCAGA
TAACAGTTTAATCGTCTGGCCGAGGTCTCGGGATAGATGGTCGATTTTGGCCATGCTGAGGATCGAAGCTTCGGTTAGCTCCACTCCGTCTCCATCCACA
CGTCGCCCATTCACTTCACTCTCACCGAGGCTTACGCGTCTCTCCTTTACATTTTCCGTCGTTTTCACATATTCCATATTCAAGTCATCAGGCCGTTTGC
ACACACCTGCGAATGCGAACATATAGTCCGCATCCAGCGCAGGTTTGGCTAACTGTGGCAGCCCGATTGGGACCAATCCAGTTTCAGTTGGCGGGCTGCC
TAGTTTAAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCGAGAGATCCTTCTTCTCGACCTTAGCTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTT
CACACCTCCCGGCATCATGAACTTGCTTGCACATCTTGCATCGCTTAAAGCAATAGTGAGCCGAATGGGTGAGTCCTCCGCAGGCGGCGCAAGGACCATA
CTGGCGTCGACCATCGCGTCCGGTGGAGTTTCGGCGCTGGTCGTCTCGGTCATACGGCCGTTGGCTGTTACTTGCCCTCGGCCGACGGTTGTCGGCGCGA
GCGAACGTTCCTTCAGCCGCATTGCGACGTTCAGTGTCGTTTGCAGCGGCCACGTGACCTCGGTCCTCGGTCGACGCGTATCCGTCGTCCGAGTACCCTT
CGGAGTATCGGTCGTCATCGCCAGAGTGAGACTCCGGTCCGTACTCCTCGGTGTCATCATATCCGCCGTTGTATACTTCTGGGTATCCTCCACGCGTGTC
TGTCGGGCGTCCCGCATTCTGCGCAGTCACTATGTCAGTCAGTGCGTCAGTGAGAGTGACCCTCGGTCGGTACTGTTGGTCATCCCGACGACGATTCTCG
TCTCGGTAACGGTCTTCCTGACGGCGGTCGTCCTCTCGGTGACGCCTGTCGCGGCGGTATCCACCCCGCGGATCTTCGGAGCGTCCACCATCGCGCCGGC
GTACTACTTCTTGCCCTCGAGGGCGGCGGACCGAGGACTCGCGTCCCGATTTTCGCTCTCTGCGACGAAGGATATCATTGATCATATCCTCGAGGTCGTG
AATGTCTTAACTCGGACATGGCACAGACGCTCTTCTAGACCTCGGTCTTCACACGAATCCAAGAAGTGCTCGACATGGTCCTTTGCATCACGACCGCCAT
GCTCGAACTGCACTCCGGCGTTGCGAGCATAGCCGTTAAGTCGGTTGAGGTAGTCGCAGACATGCTCCTTCTCCTCACGCTTGGCCGAGTAGTACCGAGC
CTTCGCAGACTGGTTGAACCTTGAACAGTAGTACTTGATGAACGCATCGCTCAACAATTTCCACGTGCGTCTCGTTTTGCGGGGCAGTTGTCGGTACCAA
TGCAGAGCACCATCTTGGAGGCTCAGTTCGAACGCCATGCACCATTCGTTGGGCGGCGTGTGCGTCCCTTTCATCTCGTATATGAAGGATCGGAGCCACT
GCATGGACTTCTCGCTCTTATCGCGGAGTCTCAAGTACGGCTTGATGTTTCCGAGTGGAAGGTGCGTGGCAATTTCTAACCTCGGTGTCGTATTGTCATT
CTCCACCGAGCTCAACTCACGGATTTGGGCGCCCATTCTCCCGTCAAGTCACCCCCGGTGTCTCCGATGTCGAACGAGTCTTCGTCCGATGAGTCATGGC
GGAGATCAAAGCGTCGGCTAGACGTCCGACTTGCACTTCATCTAGCAGTTGGAGAGGTTCGATATCCCTCGGCTTCTCTCGCCAGTCGTTCTGTACGACT
GACCGACCTAGGCGTTACCATGTGAGAGTCTTGGAAATACGTCGAGGTCGCTCCTTTGGCCGAAAATATTCCAGCCTCGGTCGACTTTCTGGGGCGTCTC
CCAGGGGTCAATGGCAACGGAATCATGGACCGGTCGACTGGGTCCGATGCGTGGCGGACGTTCAGTTGACGGCTGACTCCCGCCTCGGCCACCCCGAAGG
CCGACCGAAGCTTCTGCTTCCATTTGCGAAGCGCCGTAGCGGCGTCCTCGGGTGCCCACGCTCGGAGGTCTGCTTCCGACGGGAACACTTGGGGTTCACA
TCCCATAGCGCGTAGGAGTTGCACCGTGTCCTCGGCCACCTGCCGAGTACTCCACGACTCCACGGGCACAGTCAATTCGCCACCGAGCTCCATCCAGATG
GCTTGGCGAACAACCTCTGGAGCGAAGGATCGCATCCAGTTGCTCTTCACCTTCATGAGTTCTAGGTATCGACCCAGAACTCGGTTGGCGGCCGGGGTGT
CTCCGTTAAGAGGAGGCCGGCCGCCATTCGGCCGAGAATTCGCATCCTCGGCCATCGCCGACGATCGGTGATCGTCGGACTCATCTTCGTCGTAACCGTT
GGCTGGTTCGGGACCAGCCACTTCGTTCAACTCTTCGGTGAGGTTTCGCGCAAGCGACCTCACCCCTCCGCTGCGTCCTGCAGATATTGCAGCGGCTTCC
GAAAGCTCGGGCATCGCTGCCTTCTCTTCCACTAGCCACGAGCGAGGGCTAGAATGCAATATTGCGCTTTCGCACGAACCCCCGCAGTCCCTCAGAAGGA
AGGGTACCGGCAGTCACGCCTAATACGGGTTTGCCGAGGGTAACCTCGGCGGGTAGTGAAATACACTTGGGAACACTCAGGTTCCACCAATATATAGGGA
CCGACACTCCTTGTCGCCCCTAACTCTCGGCCACTCCTATCTCTTGGAGTGACCAGCAACAAACTCTCGGTGCAATGTACCTCAAGCTCGCTGACAGGCA
TCCCACGCAGCCGAGCGTATCCAGACCCTAAGACAAGCTAGCTAGACTTACCGAAGACGGACTTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTA
TTTCTCTTATCCTACAGCTCTGGGAGCCTCTGTAGGTCATCATTTGGCTAGTCCTATATCTCTATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAA
TCGTATAGCCGACTCTACACAGCCGAGGGTACGACACGAAATGGGTACAAACGAGGCTTTTAACCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACCTC
GGTCACTATTGTTCCTAGGTCACTATAGCGCGGGAAATGAGACCCGCCAATCAAGACGCTCTGTCGCCGTTCACTGAAAGGAGCAACGTCCGCCGGACTG
TGACAGTTCGGCACCAAAACCCAACGCCACAGTAGTACTTGCGCAGCGAAATACATGTTTGGATGCTGTAGCGCTGGAGGAGGAGGTGACACCGCCCATA
CCGAGGCCGTAGTCCACGACTAGCTGTGGGTATGGTACTGTGCTGCGGGTTCCATCCTTCTCCGTGCGCCGAACCCTGGTGAGATGCGTGCTGCAACCAG
TTGCAAGCGTGTTCACAGGCTTCGAATCCATCCAGCTTAGTGCAACAAGCTGAGGATAATCGCTCGCTTGTACGATACGGTACGTTCCTCGTGGCATTCG
CTTCGGTCGGTTTCTCTGTGTGAAGTGGATCGGACACCAGCCCAAGCGATCGAACCGTATGGTGCCAACGTGGTACAGGTCCATTTCTAGGAGCTTCAAG
CTCGGCGACACCGTAGAGTAAAAGCTATCTCTTGCTTGGCTTGTCAGGCATGAGAACGCGCATCGGGTTGAACTTGCTGTGGTTCGGCACCATGCCTTCG
TCAAACGAGATGACCTTCCCAAGTCGATACCCACGGCGAAAATTTTTCAACTGCTTGCAAAAGCGACCAAACCTTTCACGCTTTGTCAGTCTGTGCTCCA
CCGTCTTCATTGTTGTTGAAGTGAAGAAATTTCAAGATCACCTCGAAGCGATCACACTTCATGAAGCGTGAGAACGTTCCACGTGGTATAGCACCATCCT
CGTCGGCACACCAGTGATTGGAGGCCGTCTCGAATCGGAGCTATTGCTCTAGCAAATAGCAAAGCTACAGCATGCACGTTCTCGTGAGTCTGAATAGGCT
TGAACTTGTTCAGGCCTTCTTCAATATCCTCCATTTTGGGCACACTCGCGCAAGGACCTTTGACCTGGTTTGTCTTGCCGAGAAGTAGCAATGGCGATTA
TATTCTGCGTTCGGTAGTGGTTCGTCTCCTCGGCGGTGCGTATCCATAGTTTTTTGGTAAGAAGTAAAAGAGCATACCCAAGGAGAGTCTGCGTACGCAA
CAGCCGATCTTGTGGGGCCACATTCTCCGTCGTAATAGTCTGTTGCAGCATCAACTCGGAGATTGCCTTCATCGTCACAAATATATACTATCCAGAATTA
GATCAATTGCAATACAGATTATTCTGTATCATTCGTCTTGCCGGTTTGATGTTCGTCATACGTAGTCCACCCCGACTCAGCGATGGATCGGAAATCATTA
TCCGTCACGTCAAAAGCCCGATGTCGGGATCATCGCCATTCAATGGCACATCCGCTAAGTCTTCTACCCCTTCTACGAGTGCAGGTGCGGTCACATATTC
GGCCATGACGTCTTCGTCGTCCCATCTGACTCTGAATCACTCAAATTGCCAGTAATCACTACGTTTACGTCATCATCGGCTGTTGGGCCGAGCAATCGTT
CCTTCCGCAGACCCTCCATGAAGTTGTCGCTATCAAGCACATCCCAATCAACGCGGTCTTCACTCTGGTTCGGCTCGTCGTTCGTCGCTTTTTGCTTCCT
CAGCATCCGTCACGTTTTCCCTTGATTGATATTCCGGACTATCCGGATTAGCGTCACCCGTAACACCATCTTGCTCTGTATCATCCGTTGTAGGCACTAT
CGTAGTCGTTGCAACCTACATCACTGTCTCTTCGATCACCACCACTGATCCTTGAACACTTGTAGTAGCACGACCACAAACGACAGTCGACCAGGTCCCC
TCAACCACTACTGGCATCGAATAAGCTGAGTTTGGCGTCGTGGGAGCTGTGGAGAAGTGATCAGAAGATTTGGAGATGGATTGATCATTTCCGACCACGA
TGGGATGGATTGGGACCTAACATCAACGGTCAGACAATTGGCTGGTGAATGTGAGGACCATCATTCCGATCTCGGCAATCAGATCGCGGTACCACATGGT
GGGCACATGGGTTCATATCAACCGAACATATCGACATGGGTGCAGATCAACCGATCACACCAACATGTATCACTATGACCGGTACATCGGGGGTCCATGG
ACGTCAGCAATCATAGGACATGCAAGCGGGATGGGGGATAGGCACGTAGTTCTTAATAGATAAACAGAGAGCGGTTTTACTTGTAGCACGCAAGTGGTCT
TCCGAATTCCGGTGAATGAAGTATATTGACCTACCCGACGACCGGACAACCACCCTAAGTGACTCAAGCGTGATCATGGAAGCCCCTGGATAGTTTGGCC
AAGAGCGCTCCCCGTCTCCCACCAACCCAACAAGTCCCCTTCATAGGAGGCGGCAAGCATCGAAAAGGACCCCGCAAAGGATACACCCCGTGATCGATCA
CACACGATTGATACCCGAACCGACTACTGCGTGAAGCATATCCGCGTAGCAGCCAACCCCCCCCCCCCCCCGTCCCATCCCTGAAGGACCCTCAAGCCCT
AGTTCTGCTCTGTTCATCACTGACTTCCCTCGTGTGAGCGCCGGAAGAGCGGACCCCGCCCAAGCCGTCGGGTACACAAGGTGAGCTACAAAGTCAAGAT
CCGCCGGATCAACGGAGTACCCCCTCCGACAGTCGGCAGCTCGGACAACGGTTGGTTAGTTACGATCGCGTCAGCAATTTTCGTGATCTTGCACCGCCAC
AAAGCTGAGGCTCACTCGTGAGGTGGCAGCTGATCTATGGATGCGTACGACACTTCCTTGCCAACTGGAGCTCGGGCAGAGGTATTGATGTCAGGTTGAC
ATGGCGCGGGGAGCAGTATGCGAAGTTTAGGTTTGCAGCCATGTTTGATGGATATTAAATCCTGTGAGATTACTTATTCTGTATGATACAGAATACGGTG
CTAGAAGGGTTAACCCTTTCGTGAACGCTGGGTCTTCACTCAATTAAACTATACTACACAAACCAAGATGTTAAGCCGTGAAAGGGGGGCAAAATGCCCT
CTTTCATTTGCCAACGGTACTCACCTTGAAGCAATCCCTTTTGAATACTGATAGGGGGGTAGGATTTAGGAGGACTAGGGCAAAATGATATGATAAAAGG
GGGTGTTTTGCCCCCTTTGATGAGTCACACCACTACCACACCAGCTTCCGCCTGATTTTCTGATTGGCAAAAAACTTTGTCGTCAGCCACGCCTGTTGAT
TGGCTGCTCCTCTGGCTGGAGTGATGACGTAGGTTAGCAGATCCCGGACCAGATCCCGTAAGATACGAAGTA