Description :
From Genome Similarity Track
Location :
Scaffold_904:1- 1137
Transcript NameFunction/comments
g11701.t1OWY90473.1 hypothetical protein PHMEG_00041381 [Phytophthora megakarya

Sequence
1136 bases(100 bases per row)
GGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCTTCGCCGCGTGCACAGGTGCTGTGCACT
CGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATACACGACGCTGCTGGGGACCAGCAGCGGTCGCACTCGAGAGGTCCAT
TGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGACATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATT
GCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTAGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTGT
CGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAAC
TCCGCCCTCGATCGGAACTCGTTTTGCGGGGACTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGGTCTGTGAGTC
GGCGTCCGTACGCCCAACACCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGT
GTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTTAATGACTCCACGCGCGGTGTGGCCGATGGC
GACACCGAAGCTCGAGCAGTGGTTTCACGCTGTTACTTTACGATGAAACCCAGAGCAACACCGTGTTGCTCCGCCGGCGATAGCGTTCGCAACATCGTTG
CTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTCCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGA
CGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACT
ACGAAGTGCTACCAGGTGTAATGGGTCTGCTTAGAC