Description :
From Genome Similarity Track
Location :
Scaffold_5936:1- 1135
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_5936-fgenesh-gene-0.0ATP-binding Cassette (ABC) Superfamily

Sequence
1133 bases(100 bases per row)
TCCTGGGCTCCTTCACGGTGCTCGAGACGCTGAAGATGGCAGCCAAGCTCACGCTGCCCACCTCCGTGACGACGGCCATGGTGAACGAACGCGTCCAGCA
TGTGATCGACGAGATGGGCCTCCGCGTCTGTGAACACGCGCTCGTGGGCGACATGTTCCGCAAGGGCATCTCCGGCGGCCAGAAGCGCCGACTGAGCATC
GCCATTGAGCTGCTCTCTGAGCCGTCGATCCTGCTGCTGGACGAGCCCACGTCGGGTCTCGACTCTGCGTCGACGCACAACGTCATGAACTTCATTCTCC
AGCTCTGCGATGAGGGCAAGACGGTTATCTGCACGATCCACCAGCCATCATCTCTGGTCTACGACATGTTCCACAATATTGCGATCCTCACGGCCGGCGA
GACGGTCTACTTCGGCCCACGTACCGAGATCATCCCGCACTTTGGCGCTGCGGGGTATAACTGCCCGATGTACTCCAACCCGGCCGAGTACTTTATCAGC
CTCGTGAACGCCGACTTTGAAGGCCACGCCGACATTGGCAAGCTCGCGGCCTCGTACGCCGCCAGCTCGGTGGCAATCAACGTCACCCAGGCCATCTCTG
CGGACCGCAACTCGGAGCACAAGACCAAACCCGTCGAGCCGGCGCCCCCGTCCGCGCTGCGCCAGTTTGGCGTGCTCATGTACCGCAACTCGCTCAATAA
CATCCGCAACCCGGGCATCTTCTGGGTGCGACTCTTCATGTACTTCATGCTGTCGTTCATGGTCGGCACGATGTATCTGTCCACGAACGACTCCATCTCG
GACACAGACCTTGTGTCGCTGCTCTTCTTCGTGCAGGCCTTCCTGGTCTTCATGTCCGTAGCCGTGCTGCCGTTCTTCATCGAGCAACGAGCCGTGTTCA
TGCGCGAGAGAGTCAACAGCCAGCTCAACGTCTTCAGCTACGTGATCGCAAACTTCTTGGCGTCGCTGCCGGGCATCTTCCTCATCGCGCTCATGTCGTC
GATCCTCGTCGTGTACCTCGCGGGACTCCACGCCTTTGGCTACTTCCTGCTCAACCTCTTCCTCTCGCTGGTGGTCGCCGAGTCACTCATGCATGTGATC
GGTGCCGCCGTGCCGCACTACATCATCGGCATC