Description :
From Genome Similarity Track
Location :
Scaffold_4061:1- 1120
Transcript NameFunction/comments
Phypl_g16149pol protein

Sequence
1118 bases(100 bases per row)
AGCTCGCTCACATCAGTCGGGTCACGTCGGATCTGTACGATCGGATACGCATGGCGTATCGAGAGGACGAGATGCTCGTGCCTCTAGTGCGGTACCTGAC
CGCCGGCAAGGATGCCAAGGCTGACTGGTTGTCGCCGCGGCAGCGGTCCCGCCTTCACCGATATGAGTGGGCAGATGGCCTGCTCCACTATCGCGTGGAT
CCTGGTGATCCTCCTCGTGTCGTTGTTCCAAACGACGAGGATCTGAAGTACGACATACTTCAGGAGGCACACGATGCGCCAGCCAGTGGCCACTTGGGCC
GAGAGAAGACCTTCCATTCGGTCTCTCAGTCGTTCTGGTGGAACCACATGTACAAGTGGGTTGCCACCTACGTCAAGACATGTGAAACATGTCAGCGTGT
CAAGCCTGCGGGCCACGCATCGGCTCCTTTGCAGAGCCTGCCAGTGCCACTGGAGTGCTGGAAGTCGATGAGCCTCGACTTTGTCTTTGGCTTTCCAGCC
GACGACCGCGGCAACACCGGTATTTTGGTGTTTGTGTGCCGCCTGAGCAAGATGGTGCATCTTGCTCCGGTTCCCGATACGGTCACCGGGGAACAAGCCG
CGAGGCTGTTCCTGGATTGCGTGTTCCGCTATCACGGTCTTCCGGAGACCATTGTCTCTGATCGAGACCCGCGGTTTACCGCTGCGTTTTGGAAAACGCT
GTTCCAGCTACTGGGAACGAAGTTGCTCATGTCAACTGCTGACCATCCTCAGACGGACGGTCAGACGGAGCNGTGCATGCGTCAACGGGATACACCCCGT
TCTACTTGAATGGGATGCGTCATCCCCTGGTGCCGCTCACTTTACGTGGGGACACCGAGGCTTCGGTCGTAAGTGGGGAGAGGCTCGGAAGGCGCTTTCC
TCCCAGGTCTCTGAGGTGAGACCGGCCGCAATGCGCAAGCAATTGGCGTCGTTTGTCAACATCAGGCTGAATGTCATCAGCCGGGTTAGAGACGCAATGG
GGTCGGCCCAGGACAGGCAAAAGGAGTACTCTGACCGAAGTGGAAGAGGAAACTTGAACGTGTTTAATGTGGGGGACTTAGTACTCCTAGATACGAGGAA
CCTACCCATGAACACTGT