Description :
From Genome Similarity Track
Location :
Scaffold_4092:1- 1114
Sequence
1112 bases(100 bases per row)
CCCAACGTGTGTACCCCGTTACATGCTGACTCGTCAGCAGCCCAGCTATCTTCTGGAAGCAAGGCTGCATCAAAATCTGACTCGGGTGACACTCTTTTCA
GTTCGTCCATCGGTCGATCTGGTTCCAACGCTCTCGGTTTCAGCCGACTGACATGGACCCACGGGTAGAATCGATAGTCTGCTCCCTGGATCTTCAGCCT
GTACCGGAAATCATCGGACTTCTCGAGTATGCGGAACAGTCCATGCCAGATATGCGCGAGCTTCTTCGACAGTCCAGGTTTCACTCTAGCCATATACAGA
CAGACAGAATCGCCGATTTCGAATCCGGATTTGAGCCGTTCAGACAGATCCTTTTACAGCTGAGTTTGCTTCTCGGCTCGCTGCTTCTCGGTTTCAATCT
GGAGATCTCGCGCAATCCCTGCAGCCGTCTCGTACTTCTTCTGGGTCTTTGTTCTCCAGAAGTAGCTTTCCTTCAGGTCAATCTGGCTTGGTGGCTTGCT
CGACATAGCTGACATGGCATCCCAGCCGTGAACCAGGTAGATTGAAGTCTCTCTGCGGGTGGTGTCGAATGGCGTGTTTAGAGTGAACATCAGTTTTTCG
ACGATATCGTCCCAGTCGTCTTGAGCTAGGTCTTCTACATACGCACGCACGCTTCGGATGACTGTCTGGACTGGCCGTTCTTGTTGGTCGTTCGCCTGAG
GACGGTACGCTAACGGAGCTCGCTGCTGGCTTCCCATCATTTCACGAAAGTATTTGAACACTTCGCTCATGAATCTGGGGTCTCAGTCGTGTCGGATGAC
TGAGCTGGCTCCGTAATTTCTGAACACGATCCGCTCGCACGCTTCGGCGACTTCCTGAAAGGTAGTAGAGCTCATTGGCTGGCACATACAGAATCCAGAA
AAGGTGTCTTGGAAAAGCAGTAGCGCCGTGTTGCCTCGTGTTGATCTGGGTAGTGGGATGATGAAATCCATCGAGACGGTATGGAAGGGGTATGCGGCGA
TCATGTTGCCTGGTGAGGGTCCCGGATTACGTGGTGTCACTTTCCCGGCCACACAGTCAACACAAGTCCGCGCGTACTCATCCACATCTGCATACATCCC
GATCCAGTGAAA