Description :
From Genome Similarity Track
Location :
Scaffold_3951:1- 1113
Transcript NameFunction/comments
Phypl_g16109putative polyprotein

Sequence
1112 bases(100 bases per row)
CTCGTGTGTTATCACGAGTCCGATCGACATGGCGTCGCAGGTCcatgtcttcgtcttcgggaTGCGCGAAAGAATGACGCGCTACTGTCTCGCGCGCACC
ACTGTCTCACGCGCGCCGAGCCGAATACTCTGGAAAAAGCGTTCGCCCTCGCGCTACGCGAGGACTATACGGTCGCGTCTTCGTACGCTCGAGCAGTATC
ATCTGAGGCTCGAGTGTCCGCCCAGGAACCAATGGAGATTGATGCcatcgacgctgcaggtggccTCGGTCGGTCATTCAACCGCGGCAGTCGTGGCACT
GGCTCCATGAACTGGTACGGCTGTGGCAAGCCGGGTCATCGTGCGGCGGTGTTCGCGAACGCAGTCGTCCCCAGGAGCGACGCTGTGTCCCCGGCAGCCC
AGCCAAAAAACGACNCCCACCGTGCAGTATGCACACTTCaatgccaccaccagcagcggcgactcgAGGCTGATCACCGTCAGTCTTTACGTCGCcggcg
cgcggcgtcctCTCCGCGCGCTCCTAGACTCTGGAGCGTCGAATAATTTCTTCCGCGCGTCCTGCTTATCTCTGCTCCCACCCACGGTCACTATTCGCGA
GGGTCCGggtgagctcgtcgtcaagctggccgacggGAAGCCACACCGCGTTCTGCGACGCGCCATCGCGTTGCCGTACACGCTCGATGGCTTCGATAGC
AATGATGAGTTTATGGTCTACGAGATGAACTACGCATTCGACTGTATCTTGGGGATACCGTGGCTGGCACGGTATCAGCCGCAGATCGACTGGTTGGCTC
GGCCAGTCAAGCGTCGAAGTGACTTCGACGTCAGCGCGGTGTTCACCCACCTATTGGTTGCACCGACGGGCTGGCCACATGTCCGAGTCGTGGACCAATC
CACCACGACACACGCCCTGCATAGAGTGAGCGATGGCCCTGTGCGGTATGAGCCGTGTCGCTGGGTgagaacgagaacgaggcgGTCGAGTGAAGGCGAC
CCCCGCAgagtgatgaagctgtcgagcagGAGTTCCTCCTGCGTGAATCCGGCGCGGTCGAGAGCGAGCTCCCGCGCCTAGAGGAGGGTGAAGCATTGTC
CAGCGACATCGA