Description :
From Genome Similarity Track
Location :
Scaffold_3600:1- 1109
Sequence
1108 bases(100 bases per row)
CAAGCACCGTGGTTAAGTACCGTATTCCTCCTCTCACTATCGTGATCAAGTAGCCGATCAAGTAATTGCGCTTGTACAATGTACCGCATCACACTATTTT
TAGCGGCTGGCGACCGTTCAGAGTCTGCTCGCTCGCGCCTTGGCGCTGAGCAGGAGAGCTGGTCTGCGTGGCGCGACGGGAGGATGGCGATTTCTTTTCG
GCCGGCTGGGCTCTCATCGTCAGATAGAGTGCCAGCGCGCGCGGAGGGCACAGCGAGATGCCCAGAATTGTTGACACCGTCGAAGCGGGTCTATGGCACA
CGCGGATGGTGCACTGTGTTGAAGTAGAACGGCATCACACCTGTGGACGCGTGCATACTATTGTTGATGGTGAACTCTGCACATGGAAGCCAGCGACTCC
AGTCGCGAGGATGTTCAATAACAATGCCGCGAAGAATGTCCTCGACGACGCAGCTCACACGCTCTGTTTGTCCGTATGTCTCGGGATGATCGGCCGTGCT
CGCGGCCAGATCCGTACCGAGCAGAGTAAACAGTTCGCGTCAAAAGGTTGCGGTAAAGCGTGGATCCCAGCCGGCTACAATCGACTCGGGCAGTCCAAGG
TGTCCAAACACATGCTCTAGAAAGTGGCTCGCGGTCGCTTGAGCAGTCACATGCTTGCGTACCGGAGCGACATGCACCGTCTTGCTCAGTCTGTCCACAA
AGACGATTGCACAACTGTTTCTACCAGAATCTTCTAAGAAACCAAAGATGAAATCTATGCTCACCGACTTCCAGCGATCTTGCGGACTTGAGAGCAAATA
CAATGGAGCTTTGTGCTTGTCAGCAGCTTTGACACGCTGGTACCGCTCACATGCGTGCACATAATTGGCGACCCACTTGTACTGATGGGGCCAACAAAAT
ACGTCAGACACATAAAAAGGTCTTTTACCACAGCAACCTATCGTGATGGTTGAAGCGTACGAGCGTCGCCTCAAGCTTGGCTGGCAAGCAGTAAGCGACA
ACCATCGTCCTTTTCATAGAGCGACAGAATCCCATCCTTCAGCTTTATCTGGACTCGACTGGTGCTCAAATGCATGAGATCAGGAGTCGTCTCGTTACAT
GGAGGTTC