Description :
From Genome Similarity Track
Location :
Scaffold_472:1- 1108
Transcript NameFunction/comments
Physo_145089reverse transcriptase

Sequence
1107 bases(100 bases per row)
AGCTGGAAGCACTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGA
GGCAGTTCTTTATGGAGAGCACCACTGAGAGCGAGGACACTCTCAGTGCGAAGACGAAGAAGGAGCGCTTTGAGGAGCAGAGCTGGGACTCGCTGAAGTC
GAGTCCCTTCTACGAGATTCTACGGATGCACGCGGACGTGCTTCCGGAAGAGATCCCTGCGGAGCTTCCGCAGGACAAGGGCATCCAGCACGAGATTGAT
CTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTCGCAAAGCTG
GACAAGTGCGGGAATCGAAGTCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTACAACAAGTTGAA
CGATGCGACGATACCGGCGCAGACACCGATACCGCGAAAAGATGCCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCAAT
GGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCTGTGAGCACGCCAAGCAGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTC
TGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGCAAACCGTTCGTGGTCTAC
ACAGACC