Description :
From Genome Similarity Track
Location :
Scaffold_260:1- 1105
Sequence
1104 bases(100 bases per row)
TCGAGATCCTGATCGAAAGATCATTCGCTTCAAAGGCGCCAGCCACGAAGCCGGCTTCCTTCAACAGTCCGAGCAGGTTCTTCACCGCCATCAGCTTGTT
GTCCGCCACTCGGGGGGCCGAGATCGGGCCCTTCGGGTCGTCGATCTGCTCTGGCCGCAAGATCACCATGACGGGATCTTGACGCAAGAAGTCTCGCAGT
TCCTTCAAGTGATACTGACGATCCAGGTCAGCCTCGGACCAGTCGAGCGCCGACGGTCTGGGATTTTCGTCGTCCAGGCCTGGCGCTCTCAGCTTCTTCC
TCACAATCTGGTCCTTGTCCGCGATCGCGTCCAGGTAGTCCGGATCGAGCCTGATCGGCGAGTCGGCGAACGCGTATCGGTCTGATCCCGCCTTAGTTTG
TTTTGTTAGTGAATCTCGGTTCGCACCAAGATCCACCGGGGTCCCCGAAGGGACCTGTGGAGGATGTTGAGGTTTGTCTTCTAGATCTGTCTCCAGATCG
CCCTCGATTCCGTCGACAGAAGTCCTCCGAGCACTCTGTCGATCCGCGGATCTCGTTTTGTTCAGCAGCGTCTTCGTTGATCCGATATCCGACGACGCCT
CTTCCCCTGGTTCTTTCTTCACTTGCGCATCTTCTACGGACTCACGGTGAAATCCCTGGTTCGAATCCGGGCACGCACACCATTGTGGTGTAGCGGGATC
GGCCAAAATCTGGTTAAGGCCTGATCGAGCTTCCCACCAGCGCCCAGACACCGACTAACGGAGGGGGGTCCCCCAACGATCCGTGATCGGCTGAACTTGT
TCTCACCTTGTGTACCCGTCGGCGGGCTGGATATGCTCTCTCGGGGCTCCGAAGATGCAGAACTTGGTGAAGATCGAGTGTCTTGGCGTGACGCGGGGAT
AGTTTGTGGGGCAGCGCGGTAGTCTTCGCTCTGCGTCCGAGTATACGCTCCGATCGAGGGTTGTTCGCTCCGATCGGTCGGCCTGGAGTTGATCCAAGGC
CTGTAGTCGCTTTTCCGGGTGTGTTCCTTCCTTTCCTGAGTTGCTTGCCGCTTCCTATAGCGGGATCGAGGTTGATCGAGAGGAGAAACGATCGCCGGTC
AAGC