Description :
From Genome Similarity Track
Location :
Scaffold_4109:1- 1080
Transcript NameFunction/comments
Phypl_g16168reverse transcriptase putative

Sequence
1079 bases(100 bases per row)
GGGGcctgcgacgacggagaaggcTTCACCCGCTGACAGGTCTCACAGGTGCGGACCCAGTTCCGCACCCACTTGTACATGTAAGGCCAGTAGAAGTCGC
GCGACACCGTTGCGAAAGTCTTTTCGTCGCCGAGATGACCGCCAGCGGGGGACATCGTGGAACTCGTGGATGACCCGAGCTCGCAAGTCGGCGTCATTTG
GAATTACCACCCTAGGCGCATCGAAGCGGTCGATGTTGTACGTCAGCAGATCTCCATTAAGGCGGTATCGGTCGATCTGGCCGCGCTTGGTGCGCGAGAG
AGCTCCCAGTACAGTGTCGCTGGAAGTGTGCAAGTACGCGACGATGTCGCTGTACACGGAGTCGTACTCGTACGCTGCTGCGATCTCGGCGTGCAGCGGC
ATCTCGGGACTGACACTCGTCAGGTTCAAGCCTGACATGATGCACACTGCGCagtcatcttcgtcatcgtcgtcgtcagcagtCTGACGACCCAGCACCG
CACGGGGATCGTAATCCGGGCGCCGGGACAAAGCGTCGGCGAGAATGCTGTTCTTGCCCGGCTTGTagtggacgacgaagatgtACTCGGAGAACAAGGA
GAGCCACTGTGCCATGCATTGCGATAAGTGGGGGCTCTCCATCGCTGTGCGCAGCGATGCGTGATCGGTGTACACGGCAAACATCTGCTCGNTTGATCAG
AGCGTAGCGCATCGCAAGGAGTTCCTTGTCGTGGACCGGGTAGTTTCATTCTGCGGGCTTCAGCTGTCGTGACTGGTAGCTCACgaccctcgtcgtcgaa
ctgcaTTAGCGCGCAGCCGATTGCGAAGTCGCTAGCGTCGCAGACGACGTGGAATGGCTTCGAGTCGTCTGGAAGCACCAGGATCGGCGCCGAAGCCAGG
CTCCTCTTCACCGAGTCGAAGGCGGTTTGGTATTCAGGACGCCACGACCACGTGGCGtctttcttcagcagcgaagaTAGCGGCTGGATCGATCCGGCGT
AGTCTTTCGTGTACTTGTGCAGGTAGTTAGCCAAGCCCAGCCATTGACACAACTCAGTCAAGCTCTTAGGGGCTGGCCA