Description :
From Genome Similarity Track
Location :
Scaffold_2041:1- 1074
Sequence
1073 bases(100 bases per row)
CTGTAAACAGTCCACATCTCTCGCAGCGGATGAAGAGGTTGCTGTCATTCTTTACGGAGTACAACGAGTATAAACCAGGACGACTTAATTTCGTTGCTGA
CGCACTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCTGTTTTCGGCGACGCGCCTCGAGTCGTCGATCCAGATTATGGTGA
TCTGCAATTGCGTTACATGGATGAGTACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGTTGAATTTCAGC
AAGATGGTACATCTGGATGCTGCACCTGAATCCATCGACGCATCGTCTTGTGCTCGTGTCTTTATCTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTCGAGGATACGCCCATTCTTTTACGAGATGGAACGAATGCTTGCCGATGGT
GGAGTTTGCCATCAACGATTCGTCCATGCATCGACGACGCACACGTCGTTTTTGAGTGAATAGCTTGCGCCAT