Description :
From Genome Similarity Track
Location :
Scaffold_364:1- 1071
Sequence
1070 bases(100 bases per row)
AAACCATTCGTCGTCTATACGGATCATGCGTCATAACGCACGGCGACACAGTTGTCTCACCTCTCTCAGAGAAGAGCTCGGTGGCTTTACTTCTTTGCGG
TATATAGCTTCGAGGTGAAGTGTAAGCCAGGCAAATGTGTTGGCAGTTGCCCTCTCTCGCAGACCTGATTATGATCTTGCTCATGTCACGAATTTGTCGT
ATCCTATTGAGGAGTTAATTCGTGCGGCATATCCACAGGGTTCTCAGTGTGTGGCATTATTTCATGCCCTTGGGAGTTCGGAATACAAGGACTCGGATAG
TCAATAATCAGCACGCATGCGGGCCAGCCTACATCGATAACCATCGACAATGGTCTTTTGTGCTATCGCACAGATTTAGCGGATACTGCTCGCATTGTTG
TGCCTCATAATGAGGATTTAAAGTATCAAATCCTCTTTGAGGCCCACGATAATTCCTTCAGTGGGCATTTGGGCCGGGAAAAGACAACACTACTGGTAGC
CCAAACTCTACAAATGGGTGAGCACATACGTGCGTACATGCAAAAACGTGCCAGTGGGTCAAACCCTAAGCACATTCGTCTGCACCACTCACCAGTTTAT
CTGTGCCCCCGGGGTGTTGGGAGTCCATCAGTATGGATTTTTTGTTTGGTCTTCCCAAAGACTGTGACGGCAATACGATGATTGTAGTCTTTGTTGACCG
TTTAAGCTCGATGGCTCACTTGGCGGCGGTGCCGGATTCCATCGATGCCAAAGGTACAGCATGCTGTTTATCGACCGTGTGTTTCGTCAACACGGGCTGC
ACTGGTAATCATGTCTGATCGCAACCCTCGCTTCACAGGCAAGTTTTGGACATCCATCTTTAAGGTGCTTGGCACGCGATTAGATATGTCCACAGCAAAT
CATCCGCAGACCGATGGTCAGCCTGAGTAATTTAATCGCGTCATTGGCGATGTTCTTCGCAGTGTTTGTGCTGATTCACCTAAGACTTGGGGCTCGATGC
TCCCTGTCATTGAGATTGTGTTGAGAACGCTGTTCATGCCTCGACCGGCTTTACTCCCTTCTATGTGAAT