Description :
From Genome Similarity Track
Location :
scaffold_1284:1- 1068
Sequence
1067 bases(100 bases per row)
AACCCGTCACTTCGCCCCACAGTACGGGGAGCGTGATGGTGGAATACGAGGACCCTTTTACCGGTGGATTGGCGATGTCTTAGCAGACTTTGGCTTGAGT
CGTCACGATCTCTTCGGCTCAACAAGCGACGGCGGACCCGACGTCAAGTGGATGATGACGACGGGTCTGAAGTTGTGTTGGGAGTGGTGCATACCGCATT
TTACGCACGCGGCTACCAAGACTGCATTTGGTATCGTCGCTGACAACACCAAGTCCAAGAACCCAGCAATGACCGACATGCTCCGGCGAATTGTCAAGAC
CGTGTACCAGACGCAGCACGTCGAAGTCGTGGGCACCCTGTTCAGCGAGCTATGCAGTGTCATTGCAGAGGGAGATGTTAACGCCAAACAGCTACTCAAC
TTCCGCATTCATCATTTCCCGGGTCTTGCGCGCGTCGTCCGGCGCATCCTTCTACTTTGGGACCCACTTGTGGCATGGTACGAAGAGAGAGAGCGACCAA
AGCCCGACGCAGAAATGTGGTGTCGCCGGCAGCCTTCCCGCTGGCACGGGACAAAATGGAGCTCATCCAGGTACTCTCACTACTCGAGCCGATCTCAATG
CTCAATCACATTGGGCAGGCCGAGTCAGGAAACCAGTGCAATGTGCTCCTAGCGCTCTATAAATTGCGAATCTCTCTGTTGGATCCTAGCAACAGGCCGT
TATACTCGGCTTCATTGACGGTGAGACTCTCAGTATAGCCTGATCTAGCCTTGATCACCTTCCACTCGGGCAGACTCCACACGATCGCGCTGAAGGCGCC
CCCACCTCGCTTCGCACGGGCCGATTCGTCGAAACTCACAACCTATAGTTTCTCATCTCAATCCACAGTGGGGATCGGTGCTTGGATCCGGCGTTTAGGC
TCCTTCCGAGTTGCGATCGCGTTAATGCCTCGTCGATCTTGGATCTTGGCGTGATACTGGCCGCGATCGCCCCCAGTATCTCATCTTCATCCTTCGTACA
CTTCGTGATCTCAAGTGTCCACGGCGACAGGAGGGCAGACCACTGTCCTATGCGACCCTGAAGCCCA