Description :
From Genome Similarity Track
Location :
Scaffold_201:1- 1067
Transcript NameFunction/comments
Physo_144576similar to Dictyostelium discoideum (Slime mold). Developmental protein DG1037 (Fragment)

Sequence
1066 bases(100 bases per row)
TATACTCGGGCCTCCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACT
TCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCATTGCTATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTC
AGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGATCGTAAATGTATGTAGCCTTTGGTGTGTCTACACCAAAGTCGAGAAAGTCTTTCG
AACCTCTAACAGACGTCATGTCTGTTAGAGTTACAAGTGACTGTAGCCACTTGTGCGTGTAACCCTGTTACACCATCCCCCCCTCAAGGTTAGACGCACC
GAGTCACGGCACGTCAATCAGGAAATTGACCATTCGTCAATTCTTCACGTTGGGAGAAAGATAACTCGAGCTCATTCCGCAATGAGCTCGCCGCAGAAGA
AGACCGCCGCCGCAACAGAGGGTAACCTCTCTGTTGCTCAGTACCATGGGCGCCAGCAGGCAAAGCGCGACGCCCTCGCTGCAAAGGCCGCGTCGGGGAC
AACCCAGTCGGAGATTGCCCTCGAAGGTTCCTCTGTAGTCAACGACGCCGTTGACTACGGGAGTGACGACGTAGAGATGGAAGAGGGCGAGGCATCTTCC
AACAAGCGCAAGGAGTCTATCGACAGTGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCGTGAAGGAGACGACTCGGACGCTTCAAGCTCGAAGC
GTTCGCGCGGCGAGAGCGAAACTCCGCTCTCCGCTGCTGGGGCTTTAAGCTCCCCGCGTGAGGTGGCGTCTTCAAGTTCCCCGCGCGCTGCTCAGGTAGC
GCGCGATCCGTGGATGCCGTCTGCGTCAGAGATCGCAGACCGTGTGGGCAACACCGCGCCTCCAAATGANATTCCGCTGTACGTATGCAGCGGGATCCAC
AATGATGTTGTGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTC