Description :
From Genome Similarity Track
Location :
Scaffold_4201:1- 1066
Sequence
1064 bases(100 bases per row)
GAAGTCAGAGACTGCATGTTTAGCTAGGTTTTGTGTAGCTAACAGAACCAATGAGCCTTCTTTGAATTCATTCGTGTTGCCTCTGTCCACTTTGTctgcg
ttcagcttctgtcgatcagcagaagctgcaaaaAAATATTGGACAAACCGAATGACGGCTTGTCTACGCTCCACAAAGTCCATTGCTTCGGAGCTGAATG
ACTTGTTCAGCTCAACTATGTTTTCCGCTGCGGGCCCTGCCTGTGCGTGTATGCGCTTTgctacaagctcagcttATGCGTGATTGTATTTCGCTGCAGG
CCCGGCCTGTGCGTGTTCCTGAGCGGTGTCAGTGCCCGGCACAGACACGGTGTTCTTGCTCATCGTCACAACTGATACTGTGGGTGTATCCGTTGTTTTC
TGCGGTTGCTGGTTTGCAGCCGTAGATCCTCCTCCATTTAAGGCGGAAGCCACCTCCCCGAGCACGATCGGCAGGCGTGGATACCGCATGGCGTGTACGT
AGAACGGTGTATGCCCAGTCGAGGCATGAACTGAGTTGTTGTTGGTGAACTCCGCCACCGGCAAACAGTCGCTCCAGTGATGGAACGAGTGCGCGTAGCT
CTTGAGCACGTCACCGAGCACGCGATTCACGCGCTCGGTCTGCCCATCCGTTTACAGATGGTCCGCagtcgacatcgacagctgTGCTCCAAGAAATGAG
AATACTTCTTGCCAGAACAGTGCTGTAAAGCGAGGATCATGATCCGGCAAGATGCCGTGTGGCATGCCATGGTGTTGGAACACCATGTCCGCGAACAGGT
GTGCTGTTTGCAGGGCTGTTACCTCAGCCGGCATcgcagcaagatgcaccAACTAGCTGAAACGGTATATAACGACTACTGCATCAGTCCTCCGCTTGGC
TTCAGGTGGAAGACCGGAgaccgaagacgaagtccATCGAGATGGAATGCCAACACTCCGACAGATTCGGGAGTGACTGTAGTGGAGCCTGCGAGAATGG
GGAAGGCTCCACGCGCTGGCATACTTCGCAAACACGAATGTACTTGCGCACCCATTTGTACTGG