Description :
From Genome Similarity Track
Location :
Scaffold_2066:1- 1042
Sequence
1041 bases(100 bases per row)
GCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACG
GGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCACGCCCAAGCACAAGCTCTATGCGAACCTGAAGAAGTACATCTTCGG
GGCGAGCGAGACACCCGTGCTCGGGTGTCTCGTCGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCG
AACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGTCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTGACAGCTCCCGA
AGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCA
AGATCGCCCATTCCACGTTGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGCCGTGATCGTGTCGTCTACTAC
CAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCAGTACATGACAAGGACCTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTAC
TTGGAAGCAAACCATTCGTGGTCTATACGGACCACGTGTCACTGCGGACGGCTGTGAAGTCGCCGCAAATCTCGCAACGGATGGCGAGATGGCTCTCATT
CTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACACCACGACTGATGCC
GACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCGACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCT
TGCTGGCCTACGGCTCAGCGCCTTATGGCCAAGCTCGTCAG