Description :
From Genome Similarity Track
Location :
Scaffold_4232:1- 1041
Transcript NameFunction/comments
Phyta_totarag15688pol protein

Sequence
1039 bases(100 bases per row)
caccatcttgctgagGAGGCAAACGAAGACGAGAATGTCAGTGTGGCCGCGCCCATCGGGCGGTAgctcgaagatgaagtccATGCTCACGGAGCGCCAG
CAGTTGGTCGGCACCGGCAGGCTCATCAGCGGGGCTGACATCGAGGGAGCCGGCTTCACACGTTGGCACGTCTCACACATCTGGACGTAGTTCTGGACCC
AATTGTACATGTGGGGCCACCAGAAACCACGTGCCACAGACGTGTATGTCTTCTCTCGACCGAGATGTCTGCTCAGCGGGGTATCGTGAGCCTCATAGAG
GATTCGGTGCTTCAGGTCCTCGTTGTGCGGCACAACAATGCGGGGCTCGTCGCCCGCGTCGACTTGGTAGTAGAGCCGACCGTCTACTAGCTCGTAGCGA
TGTAATCGCGCTCGCTGCCGGGCTGTGAGCTGCACAGACTTTCCTTCAGCGCCCAGCGCCGCGTAATTCATCGTCGGCAGCATAGGCTTGGCGAATTAGC
TCATGGAGCGGCGACTCGAGGAAGGCTATGTGAGCCAGCTCGTAGTCTGGTCTCCTGGAGAGTGCATCCGCGAGGACGTTCTGCTTGCCAGGCTTGTACG
CCACGGTGAAGTTGTATTCGGCGAAAAAGGAGAGCCATCGCGCCATGCGCTGGGAGAGGtgtggcgacgacgtcgccgtcctcAAAGACGCATGATCGGT
ATAGATCACGAAGGTTTGCTGCCCAGCAGATGAACCCGGAACTTCACAAGTGCATACTTCATGGCGAGAAGTTCGGACAGGGTAGTTCTTTTCAGAAGCT
TTGAGATGGCGTGACTGAAAGGAGACTACCCGCTCCCTGCCTTCGGCATCGACCTGTAACAGGGCACAGCCTATGGCAAAGTCAGACGCGTCGCACACGA
CGCTAAAAGGACGGTCGTCGTCTGGCAAAGCCAATACAGGCGCACTTTGCAGGCTACGTTTCATGTCCTCAAAGGCTTGCCGAGTCTCGTCGTTCCACGA
CCATGGTGCTTCCTTCTTGAGGAGGTTCGTGAGTGGCCG