Description :
From Genome Similarity Track
Location :
Scaffold_430:1- 1029
Sequence
1028 bases(100 bases per row)
GTTAGGTTGTATAAAAGATCTATAAAAAACAGTAATGTAGGAACAACTGGATTCATTGCTTTAATGTACGATGGCATACCGCAGTCAGTCAGCTATCGGC
TCGATTGGTTAACCCCTGATAAGGCTGGATATCTAACGAGCGAAGTTCACTCGCCTTCGATGCACTGTCTTTGACTGGATTGCAACACACGGGTACAGTA
GTGGAAGAAACTTGCATTACAAGTTCCTGGATGATGGTTCGGCAGCGACCGCTTACAACTTGTAAGCCGTCGCTGCCGAACCATCATCCTGTGAAATCGC
TTTGCACAGGACAACGACGAAGACATTCAACTTGAATGTCTTCTTGGCATTGAATTTCAATTGAACACCTGCAATGCAGGCTACAGTGAGCACCTGAGAA
CAGTCACAACTAGATGTTAAGTCGAGAAAAGGGACGGAACCGACCGATATTAGGCACAAAGCAACATTGAAATGTTGTGCACTGTATCTACACTACTGTA
CGCACATGTGCAAATGGCACAGTGCCATTGAACGCCAAATCTTCAACATATCTCCGCTACATACGGCCCCGCCTAATTCGCCCTCACGATCAGTAATTCA
CTCGCGCAGATAGTACGTGTACATCCGTGCTTGGCTGTAAGAAGCATATACTGAATTGGATAAGTCTTAGAGATAAAAGTGTCACACTGGATGAAGTCGC
CCGAGAATAATTGGCTCGGGACCAGCAGTaaacagtatatttgcatctatgtgcggcctgcgcgaattttacaaccttgcggtttcaattggcgagcgtt
cACCGTCTCAAAGCATTTGAGCAGCCATTAGAAATCGTGAGTACTTGTAGGTTACTGCAGCAACAACTTGATCTCCCATATTACCATTATTTTTAATAAG
CATTAAAATACTATTCCTTGCAATGCTACAACTATCCCCTCGCAACTTGCTGTGGACCACGTTGCTGATCGTTCGCAAGCGGCCCGTCATCCACGCTCCC
AACGAGCCCGGCAACATTTGTCAAGCCC