Description :
From Genome Similarity Track
Location :
Scaffold_164:1- 1027
Transcript NameFunction/comments
Physo_144046hypothetical protein

Sequence
1026 bases(100 bases per row)
GACAGCAGGGTCTCGGACACGATGGAGGTGACCGTGGCCTTGGTGGACGTGGTCAGCGGCGTCTCCGCCGACATGGACACGGACACGGACGCGATGGTGG
CGGGCGACTCGGGCAGCAAGCACAACGGCGGCCGCAGCGCCGTGTGTGCCGTCAACAGCATGGTCTCGGAGGCTTCCGCGGCGACCGTGGCCGTGTTGGA
CGTGAGTGGCCGTGTTGGACGTGATCGGGGGCGTCTCCGCTGGCATAATCACGAACGCGACGGTGGCATTCGGCTCGGGCAGCGAACGCAACGACAGCGG
CAGTCCGCACGCAGGTTGCCGTAGGTAGTAGCGGCAGTGGCGTCGCCAGCGACATCGACAGCAGGGTCTCGGACACGATGGAGGTGACCGTGGCCTTGGT
GGACGTGGTCAGCGGCGTCTCCGCCGACATGGACACGGACACGGACGCGATGGTGGCGGGCGACTCGGGCAGCAAGCACAACGGCGGCCGCAGCGCCGTG
TGTGCCGTCAACAGCATGGTCTCGGAGGCTTCCGCGGCGACCGTGGCCGTGTTGGACGTGAGTGGCCGTGTTGGACGTGATCGGGGGCATCTCCGCTGGC
ATGGTCACGAACGCGACGGTGGCATTCGGCTCGAGCAGCGAACGCAACGACAGCGGCAGTCCGCACGCAGGTTGCCGTAGGTAGTAGCGGCAGTGGCGTC
GCCAGCCACATCGACAGCAGGGTCTCGGACACGATGGAGGTGACCGTGGCCTTGGTGGACGTGGTCAGCGGCGACTCCGCCGACATGGACACGGACACGG
ACGCGATGGTGGCGGGCGACTCGGGCAGCAAGCACAACGGCGGCCGCAGCGCCGTGTGTGCCGTCAACAGCATGGTCTCGGAGGCTTCCGCGGCGACCGT
GGCCGTGTTGGACGTGAGTGGCCGTGTTGGACGTGAGGCTACATGAAGCAAGGTGTATGCTTAGAGAAGCATATTGTCGCAGCTAGTTGGGTGGATGGCT
CAATTGTCAATGTCGTGTCTAATGCC