Description :
From Genome Similarity Track
Location :
Scaffold_863:1- 1015
Sequence
1014 bases(100 bases per row)
CTGGCTGTAGTGTACAACAAAGTGTACTCAGCAAAGAAGGAGAACCATCTCGCCATTCTTTGCGGCAAGTGAGGAGTCTTTACTGCTGTCCGCAGCGACG
CATGATCTATGTAGATCGCAAAGCGCTCCTCGCCAAGCAGATAGGCACGGAACTTGACAAGAGCATACTTCATTGCCAGTAGCTCCTTGTCGTGAACTGG
ATAGTTCCGTTCTGCGGGTCTGAGTTGTCGTGACTGATACGAAACAACTCGCTCTCGACCCTCATCATCGTGTTGCATCAATGCGCAACCGATGGCATAA
TCGCTCGCATCACAGACGACGTGGAACGGCTTGTCGTGATTCGGTAGAGCCAACACAGGAGCTTCACGAAGACTCCTCTTGACTTCTTCGAACGCCGTTT
GATGGTCTTTCGACCACTTCCACTCAATATCTTTCTTCAAAAGCTCGTGAGGGGTTGCACTAACACTGCGTAGTTGCGCGTGTACTTGTGCAAATAGTTG
GCCAGACCCAACCATTGGCGTAGCTGTTTGACGTTCTTTGGCACAGGCCAATCGTCAATAGCTTTGACCTTCTCCGGATCAACTCGAACACCGTTCTTGC
CCACAAAACATCCGAGAACAGGGATCTCGGGGGCGAAGAACATGCACTTCTTCAAGTTTGCGTAAAGTTTGTTTTCACGCATGACCTGGAAAACTTGACG
AAGATGATCAAGATGAACATCGACATCAGATCTCCCATTTGTGGCCTTACTATGAACGAAGATATCGTCGAAGTAACTCGGTGCAAATGTTCGTAAAGGA
CGAAGAACGTTCGTGACCATTCGATTGAAGGTCGCGGGTGCATTCTTCAGTCCCTGTGGCATCACTAACCATTCCCACAGCATACCGCTAGGGGTACTCA
CTGCAGTTAGTGGGACATCGTCTTTGCGCATACGAATCTGATAGAATCCATCTTTCAGATCGATAGCGCTAAAGACGGTGCTGCCAACCATCCCATCAAG
GATCATATCCTTGC