Description :
From Genome Similarity Track
Location :
Scaffold_502:1- 1012
Sequence
1011 bases(100 bases per row)
CTCGCACGGAATTAGGCTCGCGGTGTCGCACTAGTTGGCTGTGTTCGAGTGCTATCTCAATCGAGAGGTCCACGGGAAACTGTTAGACCACTCTGATCTG
TCTATCGCTGCGACTGTAGACGAGCTAAGAGTATTGTTTTGACGATGGTCCGACCAACGCCTTTTGAGCGTAGTGGAACAAGATTTGGAAATGGCCGGGC
TACGCTCACGAGCTGCCCTTCCTTCCCGATCTTACTGAAGTTGAACCTACCGAACTCGACTATGGCGCTGCAAACGTCAAGTCGAGTAGTCATACGCCAG
CACAGTCGGCTAAATTGGTGGCAGAGCTACAAAAGCACGAAGGGATAATGATTTCAAGTGGTAATGCCCTGCCGCCTCCAGCGTACGGAGCATTGTGCGA
CATCGACGTTCAAGGACACGCACCCATTAAGCAGAGAGCTCGGCGGATACCTCTCCGCCACTTGAGCAAACTTTACGAGTTGTTGAAGGGGCTGCTTCGA
GCTGGGTTGATATCATTCTCGAGCAGCCCTTGGGCCTCGCCAGTGGTGATAGTGCTAAAGAAAAATGGTGTGGATATTCGACTATGCATTGACTATAAAC
TGGTTAATGCGGTTACGACACCGATGGAATACGCTATGCCACTGGTTGATGACCTGCTTACCGAATTGGAAAGCTACTTGTGGTTTTGCTCGCTCGATGC
TGCGAGTGGATTCTGGGCAGTCTTGATGACACGCCGAGCTCGGCAGATCCCAGCGTTCGTATGTGCACTTGGACACTTTGAATGGTTACGAATGCCATTT
GGATTGAAGAATGCGCCTATGATTTATGTGGTGAAGTGCTTTCTCAGAAATAAGAGAATGGTCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTT
CAAGTGATTATAGAGGATTTGGGTTGTTTGGCACGGGTGCAAGTTGCCTGTGGTGGATTAGCCATGGCGAGCAGCACCCCGTATGGAATGACGATGGATC
TGATATAAGCG