Description :
From Genome Similarity Track
Location :
Scaffold_7164:1- 1006
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_7164-snap-gene-0.1Phospholipid-transporting ATPase

Sequence
1004 bases(100 bases per row)
GACTGGCACACTCACGTGCAATATCATGGAATTTCGCAAGTGTTCGATTAACGGCATCGCGTACGGCCACGGTCAGACCGAGGTGGGGATTGCGGCACAG
AAGCGGAGGATGGGGGAGAGCGCTGTGCCTATCGCACAGAGCTCCGATAACCAGCCGACGATCATGGAGGAAGGAGACGACGACGACGATGTGGACTCAA
AAGATCGCGTTGTCAAGGCACCATTCGTCAACTACCAAGACGACAGCATCTTCGAGGCCCTTACTCGCAACGACAAGAACGCTGCCACGATTTCGTCCTT
TTTCGAGCACTTGTCAGTCTGCCACACGGTCATGCCCGAGCGTGCCCCGGACGGCAGTGTGCGTCTCAGCGCTTCATCGCCAGATGAGCAGGCTCTGGTC
GCGGCGGCCGCGTGCTTTGGCTACAAATTCTCTGCGCGTGCCCCCGGTAAAGCCTTCGTGGAATACTTTTCCTGCTTGGCGAGCCACGAGCCACCGGCTT
CGAGTGAGAGCAACACGGGCGAGTACCAGATTTTGGAAGTGCTAGAGTTTAACAGCACGCGGAAGCGCATGTCTGTGATTATGCGCGGACCCCAAGGCGA
GCTCAAGCTACTGTGTAAGGGCGCCGACACGGTCATGTACGAGCGACTGAAGCCCACGACTGAGCCGCATGTGCTCCACGTTCGCAACCAAACGCTCCAG
CACATGGAGAATTTCGCCTCGGAAGGTTTGCGCACGCTCGTGATTGGCACGGCCGACATCGATCCCGGGTTCTACGAGAACTGGGTGCAGCGGTACCGCA
TCGCGATTAACGACATGCGCCAAATCGAGCAGCGCCGGCTGGGTGAGCCCAACGACATTGATCGTTGCATGGAAGAGATTGAAGTCAACTTGGAAGTTTT
GGGTGCGACGGCCATTGAAGATCGTCTTCAAAGCGAAGTGCCCGACACGATCCACCGTCTCCGCCAAGCGTCGATCAAGATCTGGATGCTCACGGGCGAC
AAGG