Scaffold : scaffold_161
Gene_id : Phyra_g7401
Description : DEAD/DEAH box RNA helicase, putative
TGGACGACTCGCCAGTAGTGGAGGTGTCCGCTCTCCAGCGCCTGCCCCAGCCCGGCGAGCCTATCTGCGTGGTAAGTCTCTTGCGTATCCCTTTAGCGCA
ACTTTCTTACCTCAACTTCCTCGCCCGCCTGCAGATCTGCGGTCGATACGGCGCCTATGTGTGCGACGCCACGGACGAAGACGTTTGCAGTCTCGAGTGC
CGCGACGTCTGCGTGTCCAGGCAAAAGCAGCAATCGCAGCAACAATTTCAACAATCCGAGCAACTTCGCGCCAAACTGGGCATCAATGTCTGCTGTGGAT
CGGCAACTGAGACCATCAACAACGGGGACCTGGAGCCTCGATGGCCGACCCCATTCGTGGACTTTGCGCAAAAACAAGAAGGCGTTCAATTGCCTGAAGA
GTTGCTGGTTAACTTGAGTGCCAACGGCTTTGATAGACCCACGCCCGTGCAGATGCAGACGATCCCTTGTGTGCTGCAGGGGCATAATGTACGTATTGCG
GGGTTGGAGGTTTGTGGCGTTGCTGATATTTTCTTTTCAGGTGCTGGTGAGTGCGCCAACGGGTACGGGGAAGACGGCGTCGTATTTGATTCCAGCAGTT
GCGCAGGTTTTGCGTGCGCGGGAAGAGCAGGAGGAGATTTTGACGCTAGTTGTGGCTCCTGTGCGAGAACTGGCAATTCAGATTGAGACGGTGGCAAAGC
TGCTGGTGAGAGGCATAGCTGACATGAAGACGGCGCTATTGGTGGGGGGATTCCCTGTCCCCACCCAGCGCTATCGACTACAAGGTGGAGTTCAGCTTAT
TGTGGCGACACCGGGGCGCTTCCTCGATATTTTCATGAACTACAGTGGCGGTGATGCTATCCTGGCAGCTATTCGCATGTGTATTGTTGATGAAGTGGAC
ATTATGCTGGACGCTGGCTTTCGTCCACAGATTTCTCAAATCGTGGCTTTATTGGTAGCATTAGCTGGGAAAAAGAGCGTCCAGATGCTGTTTTTCAGCG
CCACCGTCGCTGGCGAGGTAGAAGAAATGGTGCGGCAAATCTTGCAAGTTCAAAGCCAGCAAAATTATATTCGCGTCGACGTTCGTCGCAGTGATTCGAA
GACAACTGGGACACCGAGTTTCGCACTCAACCCTCGTGTTAAACAACAGGTTCGATGGTCGGACGACAAGGTGAAAAAGAGTGAGTTGTTTGAGTTCTTG
AAAGGGAAATACGAAGAGTCAACGGTGGGTGAGGTGATTGCATTGACTCTTATGGAATTTCAAGCTAGCTGACATCATTGACGGGTGGCTGATACTTTTT
GTGTTGCTGGCGTTGTAGATTGTCTTTGTCGGATCGAAACTTGGCGCGAGCATGCTGGCTGAAGCCATTGAAAAACGCTGTCAAATTGGTGCAGCAGCGA
TTCATGCAGATAAAACTCAAAGCGAAAGACTTCATCTGCTGGAGGCCTTTATTAATCTAGAGACCCCTGTCCTCGTGTCTACAAACGTGCTGAGCCGTGG
AATGGATCTGCTGCACGTTCAGAATGTTGTGATCTATGATTTTCCCAAGAAAGTGTCAGACTACGTTCACCTCGTTGGGCGTATCGGGCGTGGAGATGAT
TCGACCGGAAATGTTTTGACGCTTGTGAATAAGGATGACCAATCAGTTTTTTGGGACCTTGTATCGCTGTTGCGGCAAGCTAAAGTATCGGTGCCTCACG
AAGTGTACCAGAGTATTCACACTGAGAATGCCAAGTTGCGCGCTCGCTCCATCGAAGTCGTGATCGATGAATCTAAACGGGCTTTCCGAATTCGGAAGCA
ATTGGTTAAGGAAATGGGTACGCACGCATCAGAATGGAAGAACTGGGACAGTCAGAAGAGTAAACGGCGGCGTACAAGGCCATGATTTATTCGTTAAACT
AGTGTCAGCAAATTCATTTCGAGTATCCGGTGCGACTGGCTATTGATTATTCAGAGCGGTTAGCGTTGATAACCTCGACCACGATTCCTGTTTTGCCACT
GGATGTGATTCGGTCTCATGATTAACTCGCTCTCGTGGTTTATCACGCCTTTGTGCTATTGTCCAGAGGGCTCAGGAGGGGCCCTCCTGAGCGCTATCGC
CTTTGCTCGGAACAAGCATCGTTATAGCACTGCTTTTGACGCCATAATCAAACGCGGGCACAAACCCGCAATTCGACAGAAGTACTTAAATACATGGAGA
AGGGCATGAACACCACGGGCTTCCTCGCTACCAGAACGGTTGCTCCAATAAAAATGTAACCAAACCGCCGACCTCGCTGCTGAGAATTTGCTTCAAGTCA
ACTATCGCGCCCTGCATAACCCAACGATGACACGCAGTAGTGCTGCTCTTGATACTGATCTAGATTAGAGGTGGGGCTTCATGGTGCCGTGGTGTACCGC
ACTCAAACACAAACCCGCCCGATGTGTGATTACCCGAGACGTTACCTCCAAGCACTTGTGCCAGTCCGGGCAACTGTCGAAGAACGCTTCGAGTTTTATG
ATGGGCCAGATACATTCGAACTTGCTCGCGAGGACTTGGCTCTACTGACTGCGGTCGCAGACATGGATTACAAAGGATGGAGATACTTATTCGAGAAGCA
TTGTGCGGTGCCATTGGGTCACGAAGGGGATGAAATGTACGAGGGACACTGGATCGGAATGCTGCGAGGCGTGGATGGTACAGGCACCTCAATATGTTAA
TCAAGGACGAGCAGTGGTGTGCCGAAGAAGAGTGCCGCACGCGACGGTAAACTGAAGATATCCTCCAATTTTTTGTTTGTTTGCACCACCAAGAGAAACA
CAGTAGAGCATGCGTGCACTATTTCGCACAAATAACAGCAATGAGAACTCTCTTGCAGGGCAACAAACCAAGGCTCAACCTAAATATTCCTGTTCACGTG
CACTTCGTTGATGGGTTTGCCGATTTGACAGTGCTAGCGGATATTATGAGGGCAGAGAGAATGGTCGAGGGAGAGTGATGAGCAACCTGATACTTTTGAA
CCCCTCACATGCACCGTTATGTTGAAACCGACCTTGGTGGATTGATCAAGTGGTGGTATCAACTCGGACACATCTGAGATTTTGCGGACTATCGTGCATG
ATAAGGTGTCACCTGGTTATGCAGTCGCTTTGTAGTATCCGGATCGCCGTATTGGCAATTTGATGACAGATCGAAGTGATTAACTGGACATCCTACATGC
AGAAATATGTTGGGTGTCACATTAGGCTTGGATCTTGGTGGAACGACATAGCAGGCGATACTCTAGCTCGTCGAGAGAAAGCTGCTGCTGATGTCTTGGC
TTCGACAATATGAGCAATCTGCGAAAATTTTCGTCTTCCCTTCGCGAAAACGTTGTCGTAGCAGACAGTTCCACGAAGAATAGTGACATCGTCGTTTGAT
GCTGAGCCAAGCCGGTATACTAAGCGAGAGAACCACAACATCAATGTGAACGATCGACTGACGTAAAAAGGTATCACACGAAAGCTTAGTTGCTGACCCC
AAATAGTGCCCTCAAAGATGACCGAGTCTTGGAGTCGTAAATCTCCTGCGAAGAAGATCCGGCATATGATTGCGATGTGGTCAGCGAGCAATAAGCATAA
TATGGTTGCGGCAAACCAACTACGAAATCGAAGCATTTCCCGCATGACTGGAGTTAACGCGTCTAAGGTGAATACCCAGTGTGCCCAAAGCCACCACGAA
ATCACCATCCAGCTGTGCGCGACGTCCCAGCTGTACAAGACGCTCACAGAGATACTTGCAGACGTGACTTGAAAGGAGTAAAACACGAAGTCAAACGAAG
TAAAGAGCAACTTGAGTAGTTGGGGCTGGTAAAATCCAGCAAATAGAGATGTGAACACGCCTGTGCACAGCAGTGCGCTTGATGATACCATCAATATAAA
ATCTTCGTGTGCTGTAGGATCATCATGTGATTCATTAAACTCGTGTGCAAGGGCGACGTGAGAAAGTATCAGTCCAGCTGCTCCAACTGAATACAACACA
ACCATTGACCACAGCGAAAAGCGACGTTTGTTTGCCGTTAGCCAAGGAAGCAGCGTGTTACTCGCGGCGAAGGTCTGAGAAAAGTTGACAAACATTAAAT
GTTGCACGATATCAGTGTCTCTCAAGGATGACATCTTTGCTTTGAACATGGAATCATTCGTTTCCCACGCGGAAGATTCTGCGGTGCTTGCACTGGTTGC
AGCTTTAGTATGGCGCGATAAATGACACATTCAACGATAGCTGGTCTTTTGGGATGAGAACGCAAAACTTTGCGTCTCCGAAGCACAATTTTTGCAAGCA
GAAATCCAAGTGATACCAGTCCGTTTCCGATCACATCCAGCCCCGAGAGCTCAAAATTGCCATGTCTGGTTTGATATTTGAGAATTGAAAAGATTGAGCC
ACTATCCACGTGCCCAAGCATTATCCAAGCAAGTGCAACGAACACCGAAAAAATCGCCGCGATCAGAAAGCAAGTGAGACTGCGGAGGCCCAGAACATGA
GCATCAACACAAATGACGTGATGATATCCTATCCAGTCGATCACCGTCCGGACCGAGCGCAAATCTCCAAAGTACATCGACATCGTAACTACAATCACGC
TTGTGACAACGGAGAAGAACCAGAAGTCGAACGTTCGACACACCAAGCGCACGATATCGTATCTCAGTGTCGTCACACTTCCCAACCCCATAGGGAGCCA
TAAGAGAACGGCCAATATCGACATCACGCAGCCCACTGGAGCCTTGACCATGGGCACAATGGCGTTGATGCAGTAGGATACTGCTGCGCAAAACAAGATT
TCTCGGTAGTACTGGTAGTATCGGCGACGGATGTATGTGTGAACGCTGCCAGGAATAAGCCGGCCTCGAAACGTCTTGGATAGGTCAACGACTGGAAGCG
GCTGGGCTGGTACTAGTGAGTAGATGATGTTGCAAGATGTAGTCGAGCCTCTCTTCTCTTGGGCGGACATTGCTGAATAGCTCACGAGGTCTTGGTCTGA
TGTGCAGTACTTCTACATGTAGTTGGCACTGTAGTTGAGTCGGCAACTGGGGATCGCCTGCTGAGACACTGAACAATGATGTCTGTGCACTGGATGCTAT
CTTTGTTGACCTCACGACCTATTTGTACCGAAGTCTCTCCACCTGTTTTGATGGCTGGAGGTACTATTATTTAGCGGTATATTGTATCACCCATCGATGA
AATACTCGGCTTGATTGAAACGCGCACAATAGAAGCAGCACCCAAGGCGCCAAACCATTTTTCACTTACTGCGGAACGAGATAGTTTTCTAAAATGCATT
TCCTCGATGGAACGATGCATCAGATGACATACATTTTCGTTCAAAGAGATACCTGCTGATGACTTGGGTAGTCCGCAACCTTTCTAAGTTGTCGCGTTTG
CTACCAATTTCTTAACCCTTTCGTGGTAAAAGGAGGCATTTTGCTTCCTTTAAGCACTTTCACAAAAGTAGGTGAAAATGGACCCCCTAAAAGGAAGCAT
TTTGCTTCCTTTTAGCTTTTACCAGGGTTTCAGTAGACCGTGTTTTGTGTAAGCCAATCAGATCTTTAGATGCGGGTGGGTTAGGTGCTCCCACTCGAGG
ATTTGAGGCCGACTATCAAAATTTAAATGCTAATTTTGCACGAAAGCGCCCTGTTTTCACCCCATATCCCGTGATTTTTGTGGTTTTGCGGTCATTCACA
TGAAACGCAATGAGGAAATGGTGGGTACAGGTGGTGGAAACGAGGTGGACCCATCCCAAATTCTATCCTGGACCCGCGTGATGCTGCGCCACCAGTTCGG
GCGTCCAAACCTATCTCATACAATACTGAGGTGAGATGCTCGCCTTCACTCCTTCATTTATCGTCAGTTTCAGATGCGCACAAGTTTTTCCGACGCAGAA
GACAAGAAGCTCGTTGTTCGTGCCCTCGAGTATGAGTCCCACGGCAAGCGCGTTGCCTGGCAGGACATCGAGCTCAAGATGCGCAGGAAGCGTCCGGCAG
CACAACTCAAGATGAGATTGCGCGCTCTAAAGCGTACCTACAGTAACGACCTCGGGCGTTTCCCTACCTGTTTTTTTTCCACATGTTCGCCAACGCCTCA
ATATGTGAACAAGTTTTGCCTCCTGTCCCCAAGCCAGGCTGAAAGAGCCATCCGTGAGATTTTTGGAGCTGTTTCGGCTGCTGATGTGCGCCAGGAGGCA
GGTAAAACTGACGGAAATGCCGGGGAGATGATTCTTGCTGCGGTGTCGGGTATCATTCGAAGTATTGGAGCGGTGAAGCCAGATGATGTCTTTCTAGACA
TAGGCGCTGGTTTGGGAAATGTTGCTGCACAGTTCGCGTTGCAGACAAAAGCTAGACAGTGTTTGGGGATCGAGAAAAGGGTGGATATTGCTCGCAGGGG
GTATGAGTGCGTGCGATCATGTGCGTCGCGACTAGTGCTTCTGCACAAGGTAAGTCTGAAGTCTGGGGACGTACGCGATACGCCGCTGTGGTCGTCCGCA
CCATTTCACGATGCAACCATCATTTTCCTTAATGATTTCCTGTTTGATGAAGCCGCCAAGCTCGTGGTGCAACAAGAGCTTACTCGCATGCCAAGAGCCC
GACTGATAGTATCCACGTCTAAGTATTGCCCCCGCCACCGTGAATCATGCCGCAACAGCTTTTGCGCGAGATGGAAATTGACGGCAACTACTTACGGCCG
CGGCAGTTGGAAGGCACTACCACTTCCAATATACATATACAAACAATGCTAAAAGCCTGCAACGGACTTGCGCGACTGGACTTGACGCACGCATTCACAG
CGGCCATGACGCGCTGGGCATCGTACACGGCAGCAACATCGCGGTCAAGGCGCAACTGGACTTGGTGCAAGCGGGCACGGCGACTACGGCGCGCTGGACT
TTGTGAACGACAGCTTGGATATGGCGCGCACGGGCACGGCTGGATTAGACGACAGCGGGCGGCGACGGGACTTGGCGACTGCGAGCGCAGCTCAACAGGA
CTAAGCGAACACGGGCATGGTGGCCACGGCACTCCGAGCTGCGTGCACGGCGGCAACATATCAGGAACGTCGGCCACGGGACGCTGAACTTGGTGCCGGG
CGGCAACAGCGTGTGCTGGACTTTGCGCACATGTTTACGGCGTCCACAGCGCGGGCGCGACGCGAAAGGACTTGGCGCACGACAGCTGCAGCTTGGGATG
GACTGGGCGGCCGCAGTCTCAGCGCGAATGGACTTGGTGAAGGAGGGAACGACGGACACAACGCGGCTGGCGGCGGCTGTCAAGGCCGTGGTGATGCCCA
GAACGGCGCAGTTGGCCTACCACAGGAACGTCGCGGGCACTGGGCTGCAGTTGGAGCTGACGCTGGCGATGATGGCCGAACAGATCCCGCGGCGATGGCC
GTGGGTGCAACGCTGCCACTGTGTTATTTGGGACGAGAAACACTTGTTGATAATGCTAAAGACATTGACCATAGTTTATTCGATATATATTCGGTCATGT
TGCTCTGAAGGCATTAGCATACTTTAATCAAGATAAATACCCTCTTCTTTGCCTACAGAATGCGAATCATTGGAATATCTGTCGCGCAACTCTGCTGTCT
TGACTCGCTGAATCTTCGCTGAGCAACTCTGCACAATCACTACTGAAAAGTAGGTCGGTTTCGTCGACGGAGAGTACAGAACTGTCGCTCTGGGTCTCAT
AAGAGAGCACGACACTATCGCTTTCGGGGATAGGGAGAGCTTTATCGACGGGTCTCGCGGCGCTACTTGCCTTCAACTTAGCCAGATGCGATGACCTGTT
GACATTTCCATTGTCACTGAAGAGTCCATTTGGGAGATAGAATCTGTGAAACTTATCCCAACAAGTCCAAGTGCTCTGTGGGCACGTGTACGGACTCTCG
ATGTATCCATGCACAGTGCTACAAAGACAAACAGTGTGCGTGAGGCAATAATCCGTCACCTCTGTAGGATATCTGCCCTCGTAGCGACACACAATGCACT
GCCGACGTTTCCGCCCACTGTCCTTGAACATTTGTTTCGAAGGCATAGACTGACATCGCTTCAGGGCGCTGTGCGGGTTTGGCGAAGTGTACACTTTAGG
AGTTATACCAGTTGCATCCACTGCTGCGATTTCATCAGCAACACCGCTTCCAAACGCCATTTGACCATCGCTCGGGGCTTCTTGCCACCTGCCAGAAATT
AGCTCAGATACTAATTCAGTGACAAACGTCCTGTGGGGATCTCGATCTCTGGAAGTGTCGATTGCCATCCGTCGAGTCAGGTACGCGTTGGACCGTGCAA
TATCCACTATTGCCAAAGCCAATTTTTATGCCATTTTTTGAACGAATGACCATCAGCTAGTGAAAATCTAGCTCGTATCTGATCCAAACGATCAACACCT
TGCATGCGTCGATTGTATTGCAGGATACAGCTCGGAGCAGGAAACTCATGAGTATTTTTACCAACCCGCCGCGTGACTGTCGCGGCAGTAGATGCATCAG
CATTGGTAACCATCATCACGGTATTGCCATCGCACCACGACGCACCGAGCAAGTTGTGCTCCAGGGAGACAGACTGCTGATAGTCACCCCTTGTTGAGTG
CTCCTTCTGGAGAATAGTGTGCTTCGGATAGTGCTTACTCCTTCCCCGAACAGTTCCCCGCCCATACAACCCCTTCAAACGCAAATCCAACAGCAACTGG
ACGCTTGTGTAATAGTTGTCCATATTGATGATTCGTCGAGAGTAAAAGTAGGGCCTCACGACCTCTAGAACATGCTTACGCACTTGTTTGACATCCTCGA
GCTCCTCACGAAGCTGCTGCACCTCTTCTA
	
	
TGGACGACTCGCCAGTAGTGGAGGTGTCCGCTCTCCAGCGCCTGCCCCAGCCCGGCGAGCCTATCTGCGTGGTAAGTCTCTTGCGTATCCCTTTAGCGCA
ACTTTCTTACCTCAACTTCCTCGCCCGCCTGCAGATCTGCGGTCGATACGGCGCCTATGTGTGCGACGCCACGGACGAAGACGTTTGCAGTCTCGAGTGC
CGCGACGTCTGCGTGTCCAGGCAAAAGCAGCAATCGCAGCAACAATTTCAACAATCCGAGCAACTTCGCGCCAAACTGGGCATCAATGTCTGCTGTGGAT
CGGCAACTGAGACCATCAACAACGGGGACCTGGAGCCTCGATGGCCGACCCCATTCGTGGACTTTGCGCAAAAACAAGAAGGCGTTCAATTGCCTGAAGA
GTTGCTGGTTAACTTGAGTGCCAACGGCTTTGATAGACCCACGCCCGTGCAGATGCAGACGATCCCTTGTGTGCTGCAGGGGCATAATGTGCTGGTGAGT
GCGCCAACGGGTACGGGGAAGACGGCGTCGTATTTGATTCCAGCAGTTGCGCAGGTTTTGCGTGCGCGGGAAGAGCAGGAGGAGATTTTGACGCTAGTTG
TGGCTCCTGTGCGAGAACTGGCAATTCAGATTGAGACGGTGGCAAAGCTGCTGGTGAGAGGCATAGCTGACATGAAGACGGCGCTATTGGTGGGGGGATT
CCCTGTCCCCACCCAGCGCTATCGACTACAAGGTGGAGTTCAGCTTATTGTGGCGACACCGGGGCGCTTCCTCGATATTTTCATGAACTACAGTGGCGGT
GATGCTATCCTGGCAGCTATTCGCATGTGTATTGTTGATGAAGTGGACATTATGCTGGACGCTGGCTTTCGTCCACAGATTTCTCAAATCGTGGCTTTAT
TGGTAGCATTAGCTGGGAAAAAGAGCGTCCAGATGCTGTTTTTCAGCGCCACCGTCGCTGGCGAGGTAGAAGAAATGGTGCGGCAAATCTTGCAACGCGG
GCGCGACGCGAAAGGACTTGGCGCACGACAGCTGCAGCTTGGGATGGACTGGGCGGCCGCAGTCTCAGCGCGAATGGACTTGGTGAAGGAGGGAACGACG
GACACAACGCGGCTGGCGGCGGCTGTCAAGGCCGTGGTGATGCCCAGAACGGCGCAGTTGGCCTACCACAGGAACGTCGCGGGCACTGGGCTGCAGTTGG
AGCTGACGCTGGCGATGATGGCCGAACAGATCCCGCGGCGATGGCCGTGGGTGCAACGCTGCCACTGTCTCCTCACGAAGCTGCTGCACCTCTTCTAG
	
	
WTTRQ_WRCPLSSACPSPASLSAW_VSCVSL_RNFLTSTSSPACRSAVDTAPMCATPRTKTFAVSSAATSACPGKSSNRSNNFNNPSNFAPNWASMSAVD
RQLRPSTTGTWSLDGRPHSWTLRKNKKAFNCLKSCWLT_VPTALIDPRPCRCRRSLVCCRGIMCW_VRQRVRGRRRRI_FQQLRRFCVRGKSRRRF_R_L
WLLCENWQFRLRRWQSCW_EA_LT_RRRYWWGDSLSPPSAIDYKVEFSLLWRHRGASSIFS_TTVAVMLSWQLFACVLLMKWTLCWTLAFVHRFLKSWLY
W_H_LGKRASRCCFSAPPSLAR_KKWCGKSCNAGATRKDLAHDSCSLGWTGRPQSQREWTW_RRERRTQRGWRRLSRPW_CPERRSWPTTGTSRALGCSW
S_RWR_WPNRSRGDGRGCNAATVSSRSCCTSS