Scaffold : Scaffold_319
Gene_id : Pytul_var.sporangiiferumsnap-pug3_contig_319-abinit-gene-0.36
Description : Cryptic tubulin
ATGAGCGCGTTTGTGCACGTCGGGCAATGCGGCAACCAACTCGGCGCGGCGTACTGGCAGCTCGTGGGCAGCGACGACGACCACGATAGCGAAGACAGGA
AGGGGCTCAGTGCACCACTCGCAAAACCCCGGAAGGCCTCACCCCCATTGCGGGCCGTGTATGCGTCATCGCCAGCGACACCGTCATTGTACTACGAGCA
TTTCTTTCTTCGCCCGTCCAGGAAAGCGCGATGTGTCCTGGTGGATACCGAGCCCAAAGTGATCCGGTCGATGCTTGAGAGCGACGATGTGCACAGCGTC
TGTCGTGTATGGCCACGACATCATGAGCCTGCATTTGTACATTTCGAGCAGTCTGGACGCGGGAACAATTGGGCGATGGGGTACAATTTCCAGCGGTTCC
GGCGCAATGTGATCCCTTCAAAGACGGCAATGGCACAAGCGCATACCACTATTGCTTCATCAAAGTCTCGACAGCGTCCGGTGGTCAAATTCACGCCATT
TGATGAGGACAAGCGCGAATTGGTGGACCTCACCATGGACTCGCTACGGAAGCTGATCGAGTCAACCGATTGCTACCAGGGCACCGTACTGATGCACTCG
CTTGGTGGCGGCACTGGTTCGGGACTCGGATGCCGATTGATGGAGCTCATACGGGATACGTATCCAAAAGCGTACTTGGTGGCAGCATCCGTCGCACCGT
CGTGGAAATGCGGCGACACGCCACTGCAGAATTACAACTCGGTGTTTACACTCGCGCATCTTCAAGAGCATGCCGACTGCATCATCTACAAGGAAAACGA
CGAATTGCTGCGTACTTCCGGATACTGGAAGGCATTATTGCGAGCCCAGACTCAAGAGCAAAGTCAGCAGGACAACCTCATCGGCAACCTCGCATCAAGC
GGTCTGCCGTCGTACAGGGTATCGATCGACGAGATGAACCACTTGGCAGCAGCGGATCTCGCTGGGCTCCTTTTTCCACTTGTGCCGGAGTCTAAAATCG
CACCATCACGTGCTGCTAGTGCGCGACCATTCGACTTCGGGAAGCTCATCCATGATCTCTGTCCGTTGCACTCGGCCAAGTTCCTCGACGTCCGAACCGG
TGTGCTCACAGGGAAATCGTCATCGTCACGTTCTGCCTCGACGAAAGCCAGCAAAAGCGACCCGACGCTGTTCCATGCAGGCATTTGCCAGCACCCACTC
ACGCTTCGTTCGGGAAGTGATGATGAAATCGAGTCAATCTTGAACAAACTGGTGCGCCAAACTGCACAATCCTTCCCTCGCTCAGCGTCACACACCCTCT
CTAGCAGTGCGATCATTCGCGGGTTTCCGAGTCCAAACGACTGCAATAGGTCAACGAAGCTTCAAGCAGCAGTAGCGTCAGCTTTTCCTGGTGTATCGTG
GAATTCAGACTATCATATTGCTGTCTCGCATTCACCCTCAACTCCATTTCCATCAAACGGGGGCAAGGCATCGATCACATTATGTGTGAACAATGGGCAT
GTGCTAACAAGCGCCGAGCAGTACCTGCAACGCGCTGAGCGCCAATTCAAGGCGCGTGCGTACGTTCACTGGTACATGCAACACGGACTAGAAGAAGCCC
ATTTTCAGGACGTCTTCGAAAAATCCCGGCAGCTTATAGCTGAATACAAAGATCTCCTTCGATG
	
	
ATGAGCGCGTTTGTGCACGTCGGGCAATGCGGCAACCAACTCGGCGCGGCGTACTGGCAGCTCGTGGGCAGCGACGACGACCACGATAGCGAAGACAGGA
AGGGGCTCAGTGCACCACTCGCAAAACCCCGGAAGGCCTCACCCCCATTGCGGGCCGTGTATGCGTCATCGCCAGCGACACCGTCATTGTACTACGAGCA
TTTCTTTCTTCGCCCGTCCAGGAAAGCGCGATGTGTCCTGGTGGATACCGAGCCCAAAGTGATCCGGTCGATGCTTGAGAGCGACGATGTGCACAGCGTC
TGTCGTGTATGGCCACGACATCATGAGCCTGCATTTGTACATTTCGAGCAGTCTGGACGCGGGAACAATTGGGCGATGGGGTACAATTTCCAGCGGTTCC
GGCGCAATGTGATCCCTTCAAAGACGGCAATGGCACAAGCGCATACCACTATTGCTTCATCAAAGTCTCGACAGCGTCCGGTGGTCAAATTCACGCCATT
TGATGAGGACAAGCGCGAATTGGTGGACCTCACCATGGACTCGCTACGGAAGCTGATCGAGTCAACCGATTGCTACCAGGGCACCGTACTGATGCACTCG
CTTGGTGGCGGCACTGGTTCGGGACTCGGATGCCGATTGATGGAGCTCATACGGGATACGTATCCAAAAGCGTACTTGGTGGCAGCATCCGTCGCACCGT
CGTGGAAATGCGGCGACACGCCACTGCAGAATTACAACTCGGTGTTTACACTCGCGCATCTTCAAGAGCATGCCGACTGCATCATCTACAAGGAAAACGA
CGAATTGCTGCGTACTTCCGGATACTGGAAGGCATTATTGCGAGCCCAGACTCAAGAGCAAAGTCAGCAGGACAACCTCATCGGCAACCTCGCATCAAGC
GGTCTGCCGTCGTACAGGGTATCGATCGACGAGATGAACCACTTGGCAGCAGCGGATCTCGCTGGGCTCCTTTTTCCACTTGTGCCGGAGTCTAAAATCG
CACCATCACGTGCTGCTAGTGCGCGACCATTCGACTTCGGGAAGCTCATCCATGATCTCTGTCCGTTGCACTCGGCCAAGTTCCTCGACGTCCGAACCGG
TGTGCTCACAGGGAAATCGTCATCGTCACGTTCTGCCTCGACGAAAGCCAGCAAAAGCGACCCGACGCTGTTCCATGCAGGCATTTGCCAGCACCCACTC
ACGCTTCGTTCGGGAAGTGATGATGAAATCGAGTCAATCTTGAACAAACTGGTGCGCCAAACTGCACAATCCTTCCCTCGCTCAGCGTCACACACCCTCT
CTAGCAGTGCGATCATTCGCGGGTTTCCGAGTCCAAACGACTGCAATAGGTCAACGAAGCTTCAAGCAGCAGTAGCGTCAGCTTTTCCTGGTGTATCGTG
GAATTCAGACTATCATATTGCTGTCTCGCATTCACCCTCAACTCCATTTCCATCAAACGGGGGCAAGGCATCGATCACATTATGTGTGAACAATGGGCAT
GTGCTAACAAGCGCCGAGCAGTACCTGCAACGCGCTGAGCGCCAATTCAAGGCGCGTGCGTACGTTCACTGGTACATGCAACACGGACTAGAAGAAGCCC
ATTTTCAGGACGTCTTCGAAAAATCCCGGCAGCTTATAGCTGAATACAAAGATCTCCTTCGATGA
	
	
MSAFVHVGQCGNQLGAAYWQLVGSDDDHDSEDRKGLSAPLAKPRKASPPLRAVYASSPATPSLYYEHFFLRPSRKARCVLVDTEPKVIRSMLESDDVHSV
CRVWPRHHEPAFVHFEQSGRGNNWAMGYNFQRFRRNVIPSKTAMAQAHTTIASSKSRQRPVVKFTPFDEDKRELVDLTMDSLRKLIESTDCYQGTVLMHS
LGGGTGSGLGCRLMELIRDTYPKAYLVAASVAPSWKCGDTPLQNYNSVFTLAHLQEHADCIIYKENDELLRTSGYWKALLRAQTQEQSQQDNLIGNLASS
GLPSYRVSIDEMNHLAAADLAGLLFPLVPESKIAPSRAASARPFDFGKLIHDLCPLHSAKFLDVRTGVLTGKSSSSRSASTKASKSDPTLFHAGICQHPL
TLRSGSDDEIESILNKLVRQTAQSFPRSASHTLSSSAIIRGFPSPNDCNRSTKLQAAVASAFPGVSWNSDYHIAVSHSPSTPFPSNGGKASITLCVNNGH
VLTSAEQYLQRAERQFKARAYVHWYMQHGLEEAHFQDVFEKSRQLIAEYKDLLR_