Scaffold : Scaffold_1
Gene_id : Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.82
Description : Gene of unknown function
ATGATCGATGGCCGCGACCTGCTGCTGCGCGAGAACCTCGTGGACACGGTACTCGAGGACGGCAAGACCGAGTGGCAGTGCGTCGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACAACACGACGTTCCTGACCAACGAGACCGCGTTCCTGCACTCCGCTACGGGCGACATCCCACTG
CTGCGTAGCTCGTCGAGCGCGACCAATGCAGCCGCAGACAGCATCGAGCTCACGACGAGTGTGCGGCAGCGTGCGCTGCGGTACCGACGGCTG
	
	
ATGATCGATGGCCGCGACCTGCTGCTGCGCGAGAACCTCGTGGACACGGTACTCGAGGACGGCAAGACCGAGTGGCAACCGCGTTCCTGCACTCCGCTAC
GGGCGACATCCCACTGCTGCGTAGCTCGTCGAGCGCGACCAATGCAGCCGCAGACAGCATCGAGCTCACGACGAGTGTGCGGCAGCGTGCGCTGCGGTAC
CGACGGCTGA
	
	
MIDGRDLLLRENLVDTVLEDGKTEWQPRSCTPLRATSHCCVARRARPMQPQTASSSRRVCGSVRCGTDG_