Scaffold : Scaffold_1
Gene_id : Pytul_var.sporangiiferummaker-pug3_contig_1-fgenesh-gene-0.34
Description : Conserved gene of unknown function
ATGGTTGCCTCGGCCAAGGTCACTCGCTCCGGCATCAACGTCTTCAAGCTTTGGCTCACGGACCGCGGCACGTTTCCGATCGTGATCATCGCGAGCGGCG
CCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTGTACTTTGACAAGGAGCGCCGCGAGCGCGTGAT
CCACCACGAGGGCGAAGTCGGCGCGTCGTGGCGCCAGTTCCGCTTCCGCATGGCCAACCTGGCGCGCAACCCGATCAACCAGTCGCGCCAGTTCGACCTC
ATGTTCGAGAAGCCAGAGAACAAGGACGTCAAGAGATG
	
	
ATGGTTGCCTCGGCCAAGGTCACTCGCTCCGGCATCAACGTCTTCAAGCTTTGGCTCACGGACCGCGGCACGTTTCCGATCGAGCGCCGCGAGCGCGTGA
TCCACCACGAGGGCGAAGTCGGCGCGTCGTGGCGCCAGTTCCGCTTCCGCATGGCCAACCTGGCGCGCAACCCGATCAACCAGTCGCGCCAGTTCGACCT
CATGTTCGAGAAGCCAGAGAACAAGGACGTCAAGAGATGA
	
	
MVASAKVTRSGINVFKLWLTDRGTFPIERRERVIHHEGEVGASWRQFRFRMANLARNPINQSRQFDLMFEKPENKDVKR_