Scaffold : Scaffold_1
Gene_id : Pytul_var.sporangiiferummaker-pug3_contig_1-fgenesh-gene-0.41
Description : Gene of unknown function
ATGCACGGCAGCTTCCGCGATCTCCACCTGAGCGACACGGGCAGCAATGCCAATGCCAATGTCAATGGAAACGTCAATGGACGCAACCTGAAGAACCGGA
GCCCCACGTCCGCAGGCAGCAAATATCCTGGCCCTGACGCGAACCCGAACATGAACAACTACAGCACGTTCTCCAATGACCAGGTGTGTGTGTATGTGTG
AATGGCAATGGCGCGTCCTCATTTAACAGCTCCGCTCGTCTTGTACAGCGATTTCTGGATGATACATAACGATCGTTGCGAACTACTCTGCACAGTGATG
GCTGTTATGTATTGGTGTGAACACTTGGAACTCACATAATGTGTGTTGTTGCTTGACATGTGTGGAGTAGTCGGTGCAAACGCTGCTGCGCCAGTCAGAC
AAGATCGAGCACACGAAGAACGTCATGTACGAATCCGAGGAAGTGGCGCGAAACGTGCTCGTGGATCTGGAGTTGCAGCTGTCACAGATGCAGGATATGA
AGGGCATGCTCCACGAAACGTCGAGTATCACGGGCGAAGTGCGCTCGCTGCTCAAGAAGATCGCCGACCGATCGTATCGCCGCAAGGTATGTTGCGTACA
CACCGTAATTGAATAACGGCATATATGTATGTGCATGGTGCATACTGTTCATTCGTTGTAGGATCAAAAACCTGATAACCTTTGTGCATATGTGCATACA
GGTGCTTTTGTGGTTTATCATTATCCTGCTCGCGATCACAGACATCGTCGTGTTTTATTTGTTGTTCCTGCGTCGTCGTTAAAGATATCATGCGCTCAAT
ATATAATGAGATTTCGGCC
	
	
ATGCACGGCAGCTTCCGCGATCTCCACCTGAGCGACACGGGCAGCAATGCCAATGCCAATGTCAATGGAAACGTCAATGGACGCAACCTGAAGAACCGGA
GCCCCACGTCCGCAGGCAGCAAATATCCTGGCCCTGACGCGAACCCGAACATGAACAACTACAGCACGTTCTCCAATGACCAGTCGGTGCAAACGCTGCT
GCGCCAGTCAGACAAGATCGAGCACACGAAGAACGTCATGTACGAATCCGAGGAAGTGGCGCGAAACGTGCTCGTGGATCTGGAGTTGCAGCTGTCACAG
ATGCAGGATATGAAGGGCATGCTCCACGAAACGTCGAGTATCACGGGCGAAGTGCGCTCGCTGCTCAAGAAGATCGCCGACCGATCGTATCGCCGCAAGG
TGCTTTTGTGGTTTATCATTATCCTGCTCGCGATCACAGACATCGTCGTGTTTTATTTGTTGTTCCTGCGTCGTCGTTAA
	
	
MHGSFRDLHLSDTGSNANANVNGNVNGRNLKNRSPTSAGSKYPGPDANPNMNNYSTFSNDQSVQTLLRQSDKIEHTKNVMYESEEVARNVLVDLELQLSQ
MQDMKGMLHETSSITGEVRSLLKKIADRSYRRKVLLWFIIILLAITDIVVFYLLFLRRR_