Scaffold : Scaffold_1
Gene_id : Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.50
Description : Function: when the human ATA1 cDNA is expressed heterologously in mammalian cells
ATGACGATCTTCATGGTGCTCTTCGTTGGAGTCGCGTCGTACTGGGCCAGTTCCTGTCTGGTTCGCTTGGGTGTCGACCATGGGATCTACTCGTTCCAGG
GCCTCGCGCAGCTCGCGTTTGGGTTCCGCGGCGCATTTGTTGTCGCTGCCGCGCAATTCCTTGTGTCGCTGGGACTCATTCTCACGTACTTGACAATCAT
CTTCCAAGACTTCCCAGTGCTCCTGGGACACTCGCTCCACTTGGATTTTGACGCAAACGGCTGGCCCATGGAAACCGACAACAGTTTCGCATCCAAGATT
CTGGCCGATCGCACTCTATTCGCTGAGCTCATTGTACGTTTCCGCTGTGGTCTTCGCTCTCACCGCCAACACAAGCTAACTAACTCTGCGTTTGCTTTTT
TTGTGACCTGACAATGATGCTTTCTGTAGTCGTTCATCGTAGTGATCCCGATGTGCTTGTTTCTCTATTCCTACCGGAAGATGCAAAACTGGACCGTGGT
GATGACGTTTCTGCTGGTCATCGCATCGCTGTGTGCGGTCGGCAAAGCAAGATCCTACCATAACAGTAACACTCCGACAATGTCCCAGGGGTTTACGAGA
GACTACGTGGCAGTGCCGTCCACGCTGTGCCAGGCATTTGGGATCCTATCAACGCAATTCGCGTGCCAGCACCACACGTTCCACACGTTCTACGCGTTGA
GAAACCGGTCGATCGCGCTGTTTTCGCGCATCTCGCTGTTTGCGAGCCTACTGGTGCTCTACTTGGCATTAAGTTTTGGCATTGGCGGCTATGTGTCGTT
CCTTGGTGCTACGAAACCTGATGTGACTCAAAACTACGACTTTGAAGCAAACCGGTCGATGCTGCCGTTCTGGCTTTTCTTGCCTGTGTGCGCCATGATC
TGCATCCCGATGGAGGTAAGAGCCACACTCATTTTCTTCTCTTGCTTGAGAAAAAACTCATCCAGTTCTGTATTTCTGCAGGTGATTTCGTCGCGATTCA
CTGTGTTGCAGCTCGCTCGCGCGACCGCAGACCACGATTTGGCCCCAGAAGAAGCACTTTTCCGCGCGCAACCGGAAGGAAAGCAATATGAGGCTACCAG
TGACTCCGATCCAAATACCTCATCGCTTGAGCACAAGACGGTGCAATGCGGTGAAGATGCCTCGTACACGCGCATCCATGTCGTCATCACCTTTGTGCTG
CTCGTGATCCTCGTTCAGATTGTCGCCCTCAGCTCTCCTCTTGATCTTGGCAACGTCCTGAGTGTCACTGGTGGACTCGCAGGGATCGCACTCATCTTTG
TCTTTCCTGCTGCGTGCTACCTGAAATTGCCAGTGAGCGACGACCGTCGAGTGGGCGAGATCGCCGCTCGNNNNNNNNNNNNNNNNNNNNNCGAGTCTAC
ACGAAATACGTCCCATGGGCCAGCATTATTGTCGGGATTGTAGCTGCGATTGCGTGCATCATCGCCAACGTGGCGTAATCGTGGCTGCCTGGGGTTTCGA
CGCTCGTTTCTGCCCGCTTTGTTTGCTTCATTAGTTCGAATTCTTCTTGCCACTACTCGTTTG
	
	
ATGACGATCTTCATGGTGCTCTTCGTTGGAGTCGCGTCGTACTGGGCCAGTTCCTGTCTGGTTCGCTTGGGTGTCGACCATGGGATCTACTCGTTCCAGG
GCCTCGCGCAGCTCGCGTTTGGGTTCCGCGGCGCATTTGTTGTCGCTGCCGCGCAATTCCTTGTGTCGCTGGGACTCATTCTCACGTACTTGACAATCAT
CTTCCAAGACTTCCCAGTGCTCCTGGGACACTCGCTCCACTTGGATTTTGACGCAAACGGCTGGCCCATGGAAACCGACAACAGTTTCGCATCCAAGATT
CTGGCCGATCGCACTCTATTCGCTGAGCTCATTTCGTTCATCGTAGTGATCCCGATGTGCTTGTTTCTCTATTCCTACCGGAAGATGCAAAACTGGACCG
TGGTGATGACGTTTCTGCTGGTCATCGCATCGCTGTGTGCGGTCGGCAAAGCAAGATCCTACCATAACAGTAACACTCCGACAATGTCCCAGGGGTTTAC
GAGAGACTACGTGGCAGTGCCGTCCACGCTGTGCCAGGCATTTGGGATCCTATCAACGCAATTCGCGTGCCAGCACCACACGTTCCACACGTTCTACGCG
TTGAGAAACCGGTCGATCGCGCTGTTTTCGCGCATCTCGCTGTTTGCGAGCCTACTGGTGCTCTACTTGGCATTAAGTTTTGGCATTGGCGGCTATGTGT
CGTTCCTTGGTGCTACGAAACCTGATGTGACTCAAAACTACGACTTTGAAGCAAACCGGTCGATGCTGCCGTTCTGGCTTTTCTTGCCTGTGTGCGCCAT
GATCTGCATCCCGATGGAGGTGATTTCGTCGCGATTCACTGTGTTGCAGCTCGCTCGCGCGACCGCAGACCACGATTTGGCCCCAGAAGAAGCACTTTTC
CGCGCGCAACCGGAAGGAAAGCAATATGAGGCTACCAGTGACTCCGATCCAAATACCTCATCGCTTGAGCACAAGACGGTGCAATGCGGTGAAGATGCCT
CGTACACGCGCATCCATGTCGTCATCACCTTTGTGCTGCTCGTGATCCTCGTTCAGATTGTCGCCCTCAGCTCTCCTCTTGATCTTGGCAACGTCCTGAG
TGTCACTGGTGGACTCGCAGGGATCGCACTCATCTTTGTCTTTCCTGCTGCGTGCTACCTGAAATTGCCAGTGAGCGACGACCGTCGATTCGAATTCTTC
TTGCCACTACTCGTTTGA
	
	
MTIFMVLFVGVASYWASSCLVRLGVDHGIYSFQGLAQLAFGFRGAFVVAAAQFLVSLGLILTYLTIIFQDFPVLLGHSLHLDFDANGWPMETDNSFASKI
LADRTLFAELISFIVVIPMCLFLYSYRKMQNWTVVMTFLLVIASLCAVGKARSYHNSNTPTMSQGFTRDYVAVPSTLCQAFGILSTQFACQHHTFHTFYA
LRNRSIALFSRISLFASLLVLYLALSFGIGGYVSFLGATKPDVTQNYDFEANRSMLPFWLFLPVCAMICIPMEVISSRFTVLQLARATADHDLAPEEALF
RAQPEGKQYEATSDSDPNTSSLEHKTVQCGEDASYTRIHVVITFVLLVILVQIVALSSPLDLGNVLSVTGGLAGIALIFVFPAACYLKLPVSDDRRFEFF
LPLLV_