Scaffold : Scaffold_1
Gene_id : Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.81
Description : HECT E3 ubiquitin ligase
ATGGACCCAGCAAGAGACACAACAGCAACAGGCGTGGGTGTGATGGTCGAGACGGGCGACAAAACAGTCCCTCAAGGTGCGGCTGACGTGGACTTTGAAG
GGCTCATGTCCATGAGCTTCCGCGAGAAGAAGAAGTGGTTTCTCAAGCAGGTGAGCAGCATCCACGTGCCGTACATGGAGTCGGTGCACAAGCTCACGGT
GCGGCGCGACCACATTCTCGAGGACTCGGTCTTGGCGCTAGGTGGGTACCTGACGCCGAAACAGCTCCGCGAGCACCTCAACATCACGTTTATCGGTGAA
CCAGCTCTCGACGCCGGCGGCGTGCTGCGCGAGTGGTTTGGATTGGTGTGCAAGGAGCTCTTCAGNNNNNNNNNNNNNNNNNNNNNNNNNCGGAACGCGG
ACTGTTTTGCACGACTCACGCCGAGAACATGAGCTACTGGATCAACCCGTCGCTCAGCCGCAAGCGCGCAGCTCAGGGCAACGACGGCGATGGTGATTAT
TTAAAGTACTACACGTTCGCGGGAAGGCTGTTCGGCAAGGCGATGCTCGAGGGCCTCGTGTTTGACGCCAACATGGCACTGCCGCTGCTCAAGCACTTTC
TGAGCGTCCCGATCACGTTTTCCGACCTCGAGTTTCTCGACGAAGAGGTCTACAAGAGCGCCGTGTGGATGCGCGAGAACGACAACGTCGATAGCCTCTG
CCTCACCTTCAGCGTACAGGGCGACGGTGATGACATTATCGAGTTGAAGCCCAACGGCAACGACATTGACGTGACCGACGAGAACAAGATGGAGTACCTC
GCGCTCATGCTTCGGTACCGCANNNNNNNNNNCGTCGCGGAGCCGCTGACGGCGATGCTCGCGGGGCTCTACGAGATCATCCCCAAGAGCATGCTCTGCG
TGTTTGACTACCAGGAGCTCGACTTCTTCCTCTCGGGTCTCCCCGTGATCAACGTCAAGGACTGGCAGCTGAACACGCGCGTGCTGAATTTCGCGCGCGA
CTCGGACATCCCAGCCATCGAGCGCGAGATCCAGGTCGTATTCTGGTTCTGGGAAGTCGTCGAGTCGTTCACGGACGAGGAGCGTGCGCGGTTGCTGCAG
TTCGCGACAGGCTCGGCGCGGGTCCCAGTCGAAGGCTTCAAGGCGCTTACGAGTGCGAGCGGATACGTGCACCAATTCTGTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCCGCTCGGGATGTGTCCCCGTGCGCATACCTGTTTTAACCGCATTGATCTGCCTGTGTATGAGACCAAGGAAGATCTGGTCACGTATTT
GACTCTGGTACGTCGGAAAGAAGAACTTTGCTGGTCACCACTGAAATCGCTTGACTCACATTGTCGTTTTGTGTGTATTTTTTGTAGGTGATCCAAATGG
AAATCACGGGCTTTGGTTTCGAGTA
	
	
ATGGACCCAGCAAGAGACACAACAGCAACAGGCGTGGGTGTGATGGTCGAGACGGGCGACAAAACAGTCCCTCAAGGTGCGGCTGACGTGGACTTTGAAG
GGCTCATGTCCATGAGCTTCCGCGAGAAGAAGAAGTGGTTTCTCAAGCAGGTGAGCAGCATCCACGTGCCGTACATGGAGTCGGTGCACAAGCTCACGGT
GCGGCGCGACCACATTCTCGAGGACTCGGTCTTGGCGCTAGGTGGGTACCTGACGCCGAAACAGCTCCGCGAGCACCTCAACATCACGTTTATCGGTGAA
CCAGCTCTCGACGCCGGCGGCGTGCTGCGCGAGTGGTTTGGATTGAACATGAGCTACTGGATCAACCCGTCGCTCAGCCGCAAGCGCGCAGCTCAGGGCA
ACGACGGCGATGGTGATTATTTAAAGTACTACACGTTCGCGGGAAGGCTGTTCGGCAAGGCGATGCTCGAGGGCCTCGTGTTTGACGCCAACATGGCACT
GCCGCTGCTCAAGCACTTTCTGAGCGTCCCGATCACGTTTTCCGACCTCGAGTTTCTCGACGAAGAGGTCTACAAGAGCGCCGTGTGGATGCGCGAGAAC
GACAACGTCGATAGCCTCTGCCTCACCTTCAGCGTACAGGGCGACGGTGATGACATTATCGAGTTGAAGCCCAACGGCAACGACATTGACGTGACCGACG
AGAACAAGATGGAGTACCTCGCGCTCATGCTTCGGTACCGCANNNNNNNNNNCGTCGCGGAGCCGCTGACGGCGATGCTCGCGGGGCTCTACGAGATCAT
CCCCAAGAGCATGCTCTGCGTGTTTGACTACCAGGAGCTCGACTTCTTCCTCTCGGGTCTCCCCGTGATCAACGTCAAGGACTGGCAGCTGAACACGCGC
GTGCTGAATTTCGCGCGCGACTCGGACATCCCAGCCATCGAGCGCGAGATCCAGGTCGTATTCTGGTTCTGGGAAGTCGTCGAGTCGTTCACGGACGAGG
AGCGTGCGCGGTTGCTGCAGTTCGCGACAGGCTCGGCGCGGGTCCCAGTCGAAGGCTTCAAGGCGCTTACGAGTGCGAGCGGATACACCAAGGAAGATCT
GGTCACGTATTTGACTCTGGTGATCCAAATGGAAATCACGGGCTTTGGTTTCGAGTAA
	
	
MDPARDTTATGVGVMVETGDKTVPQGAADVDFEGLMSMSFREKKKWFLKQVSSIHVPYMESVHKLTVRRDHILEDSVLALGGYLTPKQLREHLNITFIGE
PALDAGGVLREWFGLNMSYWINPSLSRKRAAQGNDGDGDYLKYYTFAGRLFGKAMLEGLVFDANMALPLLKHFLSVPITFSDLEFLDEEVYKSAVWMREN
DNVDSLCLTFSVQGDGDDIIELKPNGNDIDVTDENKMEYLALMLRYRVAEPLTAMLAGLYEIIPKSMLCVFDYQELDFFLSGLPVINVKDWQLNTRVLNF
ARDSDIPAIEREIQVVFWFWEVVESFTDEERARLLQFATGSARVPVEGFKALTSASGYTKEDLVTYLTLVIQMEITGFGFE_