Scaffold : Scaffold_1
Gene_id : Pytul_var.sporangiiferumsnap_masked-pug3_contig_1-abinit-gene-0.130
Description : Gene of unknown function
ATGTGCTCTGACTGCTCGACATTTCGGTATTTCGAGGTCTCGCACAAGAAACATCGCGTGTGCTCTTCATGCAACAGCGATCTGGTGCAGCGGAACCGTC
TCGGTGGCCGAGAAATCGACGACGAGGCTTCTTATAATCGATCTGTCGTGACGGACGACGAACTAGACGAGGATGGCAGCTTCAATGCAACTCCGTCTAG
CAGCTCGGGGAAGAAACGCGGCAAGTTTCGTGCGAGTCTTAAAAAGACGTTCACACCAAAGCACACTAAGAAAAGCGGCGATGAGCGACGGAGAGCGAAC
GAGGACATAAACAATGTTGCTGCCAGTTGCGAGAGCAACGTTCGTGAAGGCGTTCAGATACCTGTGCACCGACCTCTTGAGGAGAGGAAACAATCCAGTG
ACCTGTTTGATGTCGCGGACGATACGTGGTTCACTGATCCACACGAAGGCGAAGTCCGAAACGCGGCGTCAAAGAAGCAGAATCTGTTTGACTTTGATGA
CGACGATTCCAACTTCGATTCAAGAAAACGCAACGAGAACCAGCGGTACTCTTTGGCACAGCCCAAGTTA
	
	
ATGTGCTCTGACTGCTCGACATTTCGGTATTTCGAGGTCTCGCACAAGAAACATCGCGTGTGCTCTTCATGCAACAGCGATCTGGTGCAGCGGAACCGTC
TCGGTGGCCGAGAAATCGACGACGAGGCTTCTTATAATCGATCTGTCGTGACGGACGACGAACTAGACGAGGATGGCAGCTTCAATGCAACTCCGTCTAG
CAGCTCGGGGAAGAAACGCGGCAAGTTTCGTGCGAGTCTTAAAAAGACGTTCACACCAAAGCACACTAAGAAAAGCGGCGATGAGCGACGGAGAGCGAAC
GAGGACATAAACAATGTTGCTGCCAGTTGCGAGAGCAACGTTCGTGAAGGCGTTCAGATACCTGTGCACCGACCTCTTGAGGAGAGGAAACAATCCAGTG
ACCTGTTTGATGTCGCGGACGATACGTGGTTCACTGATCCACACGAAGGCGAAGTCCGAAACGCGGCGTCAAAGAAGCAGAATCTGTTTGACTTTGATGA
CGACGATTCCAACTTCGATTCAAGAAAACGCAACGAGAACCAGCGCCCAAGTTAG
	
	
MCSDCSTFRYFEVSHKKHRVCSSCNSDLVQRNRLGGREIDDEASYNRSVVTDDELDEDGSFNATPSSSSGKKRGKFRASLKKTFTPKHTKKSGDERRRAN
EDINNVAASCESNVREGVQIPVHRPLEERKQSSDLFDVADDTWFTDPHEGEVRNAASKKQNLFDFDDDDSNFDSRKRNENQRPS_