Scaffold : Scaffold_1
Gene_id : Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.62
Description : Cysteine protease family C01A
ATGGTGGCGTCTGTGTCTAGACTCGTGTGCCTCTCACTGCTCGCTGCGACTGTCACTGCCGAGCGCCACGCGTCGTACGACGAGTGGAAGCAGTCTAAGT
ACTACAAGGAAGCGTGCAACAAGAAGTTCCTTCCGCCTTCGAGCTTTTCGCAAAACACGGGCGAGTTCTCCATGGGCACAGCCACCGGAAGTGGCGATTC
GAGTGTCACGGCAGTGGAGAAGAAGCGCTTTGACCAGGCGCTGACTGACATCGAAGAGCTTCAGAAGCTGCACCCGTACGCCAAGTTCTCGGTCAACACG
CCGTTCGCGCTCATGACGCACGACGAGTTCCTGGCGTACGTCAACCGCAACAATGTGAACCCAGACCTCAGCCCACTGCACCACACGATCCACTCGACGA
GCAGCTCTTCGAATAGCTCTGCACCGATGACTGGAGCTAGTGCGACTACGACGACCTCTAGTGGAAGCAAGGACGGCGGCCTGAAGACTAGTGCTGCTGC
ATCTGGCGAGACTGTCGACTGGCAGCAGAAAGGTTGCGTCACGGCTGTCAGGGACCAGTCGAACTGTGGTGCANNNNNNNNNNCTGTCGACTGGCAGCAG
AAAGGCTGCGTCACGGCTGTCAAGGATCAGTCCCAGTGCGGCGCGTGCTGGGCGTTCTCGGCCACAGCAGCCATGGAGTCCGGTGTCTGCGTCGAAACTG
G
	
	
ATGGTGGCGTCTGTGTCTAGACTCGTGTGCCTCTCACTGCTCGCTGCGACTGTCACTGCCGAGCGCCACGCGTCGTACGACGAGTGGAAGCAGTCTAAGT
ACTACAAGGAAGCGTGCAACAAGAAGTTCCTTCCGCCTTCGAGCTTTTCGCAAAACACGGGCGAGTTCTCCATGGGCACAGCCACCGGAAGTGGCGATTC
GAGTGTCACGGCAGTGGAGAAGAAGCGCTTTGACCAGGCGCTGACTGACATCGAAGAGCTTCAGAAGCTGCACCCGTACGCCAAGTTCTCGGTCAACACG
CCGTTCGCGCTCATGACGCACGACGAGTTCCTGGCGTACGTCAACCGCAACAATGTGAACCCAGACCTCAGCCCACTGCACCACACGATCCACTCGACGA
GCAGCTCTTCGAATAGCTCTGCACCGATGACTGGAGCTAGTGCGACTACGACGACCTCTAGTGGAAGCAAGGACGGCGGCCTGAAGACTAGTGCTGCTGC
ATCTGGCGAGACTGTCGACTGGCAGCAGAAAGGTTGCGTCACGGCTGTCAGGGACCAGTCGAACTGTGGTGCANNNNNNNNNNCTGTCGACTGGCAGCAG
AAAGGCTGCGTCACGGCTGTCAAGGATCAGTCCCAGTGCGGCGCGTGCTGGGCGTTCTCGGCCACAGCAGCCATGGAGTCCGGTGTCTGCGTCGAAACTG
GC
	
	
MVASVSRLVCLSLLAATVTAERHASYDEWKQSKYYKEACNKKFLPPSSFSQNTGEFSMGTATGSGDSSVTAVEKKRFDQALTDIEELQKLHPYAKFSVNT
PFALMTHDEFLAYVNRNNVNPDLSPLHHTIHSTSSSSNSSAPMTGASATTTTSSGSKDGGLKTSAAASGETVDWQQKGCVTAVRDQSNCGAVDWQQKGCV
TAVKDQSQCGACWAFSATAAMESGVCVETG