Scaffold : Scaffold_1
Gene_id : Pytir_DAOMBR486maker-pir_contig_1-snap-gene-0.46
Description : Nucleoporin
ATGTTCCGCGCACGCAAGTTCGTGGAAGTGCCATCGAAGCGCAGCGGCGGGTTGCTCTCGCCCCCGCACCCGGATCTGCTCGTGGCCACGGGTGGCACCG
CGACCACGACGACAGAGAGCAAGCGCCAACGCCTGCAACTCGAAGCCGCCGAGTCGTTCTTTTCCAACAATCAGCAGCCGCAGATGATGATGGCGCCTGC
CGCAACAGTCTCCATGGATGGTGGTCGTGACGATGCCACCGAGAACGTGCTCATCGAGACCCCTGAGTGCACGATCACGATGGTCGACACACTGCCGAGC
TTCATTAGTGACGATATCCGCAAGGAGAATGGCGGGCACAAGCAGCAGCAGTTCCCACAGATTGTATCGTGCCGCGCGTCTATCCCATCCGCGCGCCACA
GCAGCGGGCGCCAGTGGATCGTGTACTTTGTCGTGGTCTTGCGCACGAAGATCCTGCTGTGGCAGGAAGAGCAGGGGAAAGTGATCTCGCTGTCGCTCCC
GGACGAATTAGAGGACCGCGAGGTGCTGAACCCGTTCCTCTTTGCGCTCTACGGACAGAGTCTGTCGCTGATGGTGATCGGCAAGAGCGGCATCGTGCTC
TTTTGGGAAGACATTGATCTCCCCTACGAGAGCGTGCCACTGAGTGTGCAGATCCCGTTGCAGTACGAAGAAGAGGTGTTCACGAACGCCGACGCGATCA
TGTCGACCGTGGACCAGCAGGAGATCTCGCAGCTGCAGCAGTCGCCCGAAGAGGACCTCAAGAGCATCGTGTGCTGGAGCAACCAGGGCAACATCTGGGA
AGTCGCGATGGAGGACCGTCGTATCCGCGTGCGTGCGTTCGAGAAGCGCAACGGTGGCTTCCTCTCGGGACTGACCAAGTCGGTCTCGCAGTTCTTCTTC
GCGTCGGCGTCGCGTTCAAGCAGCGGACAGTACGGAGGGGAATTGGACCCGAACCTCCCGATCAAGTACGTCAAGGTGGTGCCTTCGGTCGCCGACGGAA
TCGTGAGCGACGAGACGGCGGACATGCTCGTGCTGTTCAGCAACGGAATTGTCGAGCGCCGCACGTTCAGCACGGGCGACGTCATGGACTGCTCGTGTGT
ATCAGTGAAGCACTTTGACGCCACGCGCGTGGCGATCAGCTACTTTAGCGACAATTTCCCAGATCAGCACCTCGCGAAAGTGGAGATCGTGTCGCTTCCC
TACGTTCTCGATAACTGCTTTGCGCTGCTCGTGGCGTTCGTGTGCTCCACGAGACAGGAAGCGTCCGCGAAGGTGAAGTACGCAGTATTCCAGTTCTCGC
TCGGATCGACGAGCGAATCCCCCGAACCAGAGTGGGCGTGTGTGCTGGACTACGAGCCATCGTTCTCGGAGGTCGGCGACACGAGTCGCTACTTCCACGT
AGACTGCTTTGGCGTCGCGCGCGGCGCTTTCTACCTTGTGTGGACAAAGGCGCTGCCGATCCAGTTTGCGTCGATCCTGCTTCCGCGCTCGGGTCAGACG
ACTGTGCGCTACGCGGCTTTCTCACTGCAGGGTGTGCACAACCGCACTGCGGTCGGCTTTGGTGCGCGACTGGAGGCGAACGCGTTTGCTGGCGATGCGA
TTAAAGGCTCGGTGTCTTTTGTACTCATGGAGGACGACAACAAGCTGCCTCATGGCGGAACAGTCTGCGTCGCGACTGCATCGAACATGCAGAAAGTGGA
AGCGCTGCCAGCGCAATCGGCTTCGAGAGGTGCCGCCTCGACTTCGCTCCACGAGAAGAGCCGCAAGCGTCTGGAAGAAGCAAGCCGGCTCACGGGCGAG
TCTCCGCACTTCCTCGCCGAGAATCTGGACGTCCAGGAGTATGTGCGTCTGCTGACAACGCATTTCCACGACGACCCGTACTCAACGTCGCCGCTGCGGA
TTGCAAATAAAGACGCGTTTGCTGTTGCCCAAGCTGCTATTGCGATTGATTTCCAGATTTTAGACGCGAAGCCTTCATCGGGTCTGCGATGGGGCAAGGA
AGATACAGAGGGTAGTACCAGTCACCAAACAAAGAAGAATGGTAGCAATCCGGCGTTGGTGACTCCGAAGCTCGTGCGTTTCCAGCTCGAGGAGAAGCGC
ACTCGCCACGTCGAGTTCCTGGATTTCCTTCAACGGCGGTGCGCGAACGTGTGGCAAGTGATCGTCAAATCCCCGGAGCTCAGTCGGTACTTGACAGAAG
ACGAAGAGAAGCTGAACGCTGCGATCTCGCTGAGCAAGTTCCAAGGCTCGCTTCACACTCAAAAGCCCACAGAGGATCCGCTTTCTTCAACCTCTTCGAG
TGGCAGCATCCAGCGTCGATTGACGGGTCAGTTCTTGCTGCACGCGATCGAGAAGACTGTGGAGCAGCGCGGGTACCAGAAAGAGCAGCTCCGTTTGGCT
GGCTACAACGCGTTTGACATCTTCTACTGCGAAGTGAGCAAAATCACTGAGCTGTTCCAGTTGCTTAGCATGGAAGTGCAGAAGCTGGGCACTTCGATTG
GCGAGAGCGACCCAACGTACCTGTATGCGCTCCTGGAAGCTGGATACAGTATGCTGAGCATGCTCAAGCCCTCGTCTGTGAGCTCGGAGTCTCAGGCGTC
TAGTGGTGGCGCGTTCACTGCGACGGGGAGCTGGGCATTCACGCGTCAAGTGCGCGAAGTGATCGTGGACCAGGTCTCCCGTCTGACTGTGCTGGTTGGT
TACTCGACTCTCTCTGGCGAGAAACGCATCCGCTGGGAGAATGACGAGATCTTCGAAGTGACGGACCAGATCAAGAGCCTCGGATGTGTTCTCTTGGATG
GCTACCTGCGCTTTTTGCCAGCTTTGCAGGGCGAAGAAGCCGAAGATCTGCGGAAAGAGTCGGAGCTGAGCAAGCGCTACGTCCTGAATCCGCTCGTGTA
CGTTGCGACGAACACTGCGCTCGACACTGACCGCGCGGGGGACTTTGAGCAAGATGGCTTCCTTGAGCGAAAGCGCAACGAGCTCTTTGCGCAGTGCGTG
AAGCTGTCGGAGAAGTACGCGTACTACGAAGGTATGGTGTTCTTGGTGTACACGGAAGACCAGGCGAACCTGTCCAAGCTGGACTACGTGCTGGGCAAGC
TGCCGAAGAGCGCGTCGACGAAGCGCCTGGAAACGTACTGCAAAGCCTACGACGGGTTTGCGCAGTTTCTGTTTAGCTGGTACGGTGGGGAAGTGCGCAA
CCCGTGGCCTGTCTCCGCCGTGTACGAGCGCAAAGCGCGATCGACGATGCTCGCGTATATGCTCAGCAACTCGAAGTTGTACGGAGGGTCGCTCCATCAG
TACATGAAAGGACACGAGACGCTCTCGAAGAATTGCTGGATGACGGCGATCTCGATCGAGCGCTACGACCAGACCGCGTCGCTTGCTCTCCACGAGGCAG
AGCACGAGCGTTCATCGCTCTCGAAGCGCAAGAATCTGACGAGTCTCGCGAAGATCGCGGCACTCGCAGCTCCAGACACGTCTCGCAACGAAGAAAACAT
GCAACAGATCAAGCGCGAGGTACGCAAATCATTCGTTTCGAGTTGGTTTCTGTGTGGATGTATGGGTTAACCGACGAAGTTGCTTTCTTTTGTCAATGGG
TGTAGCTGGTCCGCATCAAAATCCAGGAAGTGCTACAGCAGCAACTGCCATCAGAGCAAGCTATCGACGCCTCTCGTCCGCTGACTTGCGATGAGCTCGT
GGACATGTGTCTCGAGGCTTCGTTGTCTGTCGCAAGGAACGATCCAATCAGGTACAGATATGTTTCCTTGTGCATTCACATGTGTGCTTTGCAGTTTAGT
CATCTGATATTTGCTTCCACTGATTTATCATTAGAACGAACTTGTTCCTCATGGCGCTGGAAGCCGTAGAGAGCATGCAGGACACGGACTCAGGCGAGTT
TGACGTGGCGCTCGCGAGAGTGTGGCACCACTGCCTCTGCGAGGACGAGGAGCTCTGGGAGAGCCTGCTGCAGGAGTACGCGTCGGGCGTGAACGAGCAG
AAGCTGGAGCTGTTGATGCGCGAGACGCTGCTTTACTCTGCGATGACGCAGTATTTATCCTCCAANNNNNNNNNNGCCGCCAGCACCTGTCGCCGTCGTT
CGCGTCTGCGGCGCTTACGATCGAGATCCTGGACGACTTGATCGAGAACGAAGAGCACGAGCACTCGATCATCAGCGCGCGCAGCCGCCAGCTGTTTGCC
AAGACGCTCAGCTTTGCGATGACGCACTA
	
	
ATGTTCCGCGCACGCAAGTTCGTGGAAGTGCCATCGAAGCGCAGCGGCGGGTTGCTCTCGCCCCCGCACCCGGATCTGCTCGTGGCCACGGGTGGCACCG
CGACCACGACGACAGAGAGCAAGCGCCAACGCCTGCAACTCGAAGCCGCCGAGTCGTTCTTTTCCAACAATCAGCAGCCGCAGATGATGATGGCGCCTGC
CGCAACAGTCTCCATGGATGGTGGTCGTGACGATGCCACCGAGAACGTGCTCATCGAGACCCCTGAGTGCACGATCACGATGGTCGACACACTGCCGAGC
TTCATTAGTGACGATATCCGCAAGGAGAATGGCGGGCACAAGCAGCAGCAGTTCCCACAGATTGTATCGTGCCGCGCGTCTATCCCATCCGCGCGCCACA
GCAGCGGGCGCCAGTGGATCGTGTACTTTGTCGTGGTCTTGCGCACGAAGATCCTGCTGTGGCAGGAAGAGCAGGGGAAAGTGATCTCGCTGTCGCTCCC
GGACGAATTAGAGGACCGCGAGGTGCTGAACCCGTTCCTCTTTGCGCTCTACGGACAGAGTCTGTCGCTGATGGTGATCGGCAAGAGCGGCATCGTGCTC
TTTTGGGAAGACATTGATCTCCCCTACGAGAGCGTGCCACTGAGTGTGCAGATCCCGTTGCAGTACGAAGAAGAGGTGTTCACGAACGCCGACGCGATCA
TGTCGACCGTGGACCAGCAGGAGATCTCGCAGCTGCAGCAGTCGCCCGAAGAGGACCTCAAGAGCATCGTGTGCTGGAGCAACCAGGGCAACATCTGGGA
AGTCGCGATGGAGGACCGTCGTATCCGCGTGCGTGCGTTCGAGAAGCGCAACGGTGGCTTCCTCTCGGGACTGACCAAGTCGGTCTCGCAGTTCTTCTTC
GCGTCGGCGTCGCGTTCAAGCAGCGGACAGTACGGAGGGGAATTGGACCCGAACCTCCCGATCAAGTACGTCAAGGTGGTGCCTTCGGTCGCCGACGGAA
TCGTGAGCGACGAGACGGCGGACATGCTCGTGCTGTTCAGCAACGGAATTGTCGAGCGCCGCACGTTCAGCACGGGCGACGTCATGGACTGCTCGTGTGT
ATCAGTGAAGCACTTTGACGCCACGCGCGTGGCGATCAGCTACTTTAGCGACAATTTCCCAGATCAGCACCTCGCGAAAGTGGAGATCGTGTCGCTTCCC
TACGTTCTCGATAACTGCTTTGCGCTGCTCGTGGCGTTCGTGTGCTCCACGAGACAGGAAGCGTCCGCGAAGGTGAAGTACGCAGTATTCCAGTTCTCGC
TCGGATCGACGAGCGAATCCCCCGAACCAGAGTGGGCGTGTGTGCTGGACTACGAGCCATCGTTCTCGGAGGTCGGCGACACGAGTCGCTACTTCCACGT
AGACTGCTTTGGCGTCGCGCGCGGCGCTTTCTACCTTGTGTGGACAAAGGCGCTGCCGATCCAGTTTGCGTCGATCCTGCTTCCGCGCTCGGGTCAGACG
ACTGTGCGCTACGCGGCTTTCTCACTGCAGGGTGTGCACAACCGCACTGCGGTCGGCTTTGGTGCGCGACTGGAGGCGAACGCGTTTGCTGGCGATGCGA
TTAAAGGCTCGGTGTCTTTTGTACTCATGGAGGACGACAACAAGCTGCCTCATGGCGGAACAGTCTGCGTCGCGACTGCATCGAACATGCAGAAAGTGGA
AGCGCTGCCAGCGCAATCGGCTTCGAGAGGTGCCGCCTCGACTTCGCTCCACGAGAAGAGCCGCAAGCGTCTGGAAGAAGCAAGCCGGCTCACGGGCGAG
TCTCCGCACTTCCTCGCCGAGAATCTGGACGTCCAGGAGTATGTGCGTCTGCTGACAACGCATTTCCACGACGACCCGTACTCAACGTCGCCGCTGCGGA
TTGCAAATAAAGACGCGTTTGCTGTTGCCCAAGCTGCTATTGCGATTGATTTCCAGATTTTAGACGCGAAGCCTTCATCGGGTCTGCGATGGGGCAAGGA
AGATACAGAGGGTAGTACCAGTCACCAAACAAAGAAGAATGGTAGCAATCCGGCGTTGGTGACTCCGAAGCTCGTGCGTTTCCAGCTCGAGGAGAAGCGC
ACTCGCCACGTCGAGTTCCTGGATTTCCTTCAACGGCGGTGCGCGAACGTGTGGCAAGTGATCGTCAAATCCCCGGAGCTCAGTCGGTACTTGACAGAAG
ACGAAGAGAAGCTGAACGCTGCGATCTCGCTGAGCAAGTTCCAAGGCTCGCTTCACACTCAAAAGCCCACAGAGGATCCGCTTTCTTCAACCTCTTCGAG
TGGCAGCATCCAGCGTCGATTGACGGGTCAGTTCTTGCTGCACGCGATCGAGAAGACTGTGGAGCAGCGCGGGTACCAGAAAGAGCAGCTCCGTTTGGCT
GGCTACAACGCGTTTGACATCTTCTACTGCGAAGTGAGCAAAATCACTGAGCTGTTCCAGTTGCTTAGCATGGAAGTGCAGAAGCTGGGCACTTCGATTG
GCGAGAGCGACCCAACGTACCTGTATGCGCTCCTGGAAGCTGGATACAGTATGCTGAGCATGCTCAAGCCCTCGTCTGTGAGCTCGGAGTCTCAGGCGTC
TAGTGGTGGCGCGTTCACTGCGACGGGGAGCTGGGCATTCACGCGTCAAGTGCGCGAAGTGATCGTGGACCAGGTCTCCCGTCTGACTGTGCTGGTTGGT
TACTCGACTCTCTCTGGCGAGAAACGCATCCGCTGGGAGAATGACGAGATCTTCGAAGTGACGGACCAGATCAAGAGCCTCGGATGTGTTCTCTTGGATG
GCTACCTGCGCTTTTTGCCAGCTTTGCAGGGCGAAGAAGCCGAAGATCTGCGGAAAGAGTCGGAGCTGAGCAAGCGCTACGTCCTGAATCCGCTCGTGTA
CGTTGCGACGAACACTGCGCTCGACACTGACCGCGCGGGGGACTTTGAGCAAGATGGCTTCCTTGAGCGAAAGCGCAACGAGCTCTTTGCGCAGTGCGTG
AAGCTGTCGGAGAAGTACGCGTACTACGAAGGTATGGTGTTCTTGGTGTACACGGAAGACCAGGCGAACCTGTCCAAGCTGGACTACGTGCTGGGCAAGC
TGCCGAAGAGCGCGTCGACGAAGCGCCTGGAAACGTACTGCAAAGCCTACGACGGGTTTGCGCAGTTTCTGTTTAGCTGGTACGGTGGGGAAGTGCGCAA
CCCGTGGCCTGTCTCCGCCGTGTACGAGCGCAAAGCGCGATCGACGATGCTCGCGTATATGCTCAGCAACTCGAAGTTGTACGGAGGGTCGCTCCATCAG
TACATGAAAGGACACGAGACGCTCTCGAAGAATTGCTGGATGACGGCGATCTCGATCGAGCGCTACGACCAGACCGCGTCGCTTGCTCTCCACGAGGCAG
AGCACGAGCGTTCATCGCTCTCGAAGCGCAAGAATCTGACGAGTCTCGCGAAGATCGCGGCACTCGCAGCTCCAGACACGTCTCGCAACGAAGAAAACAT
GCAACAGATCAAGCGCGAGCTGGTCCGCATCAAAATCCAGGAAGTGCTACAGCAGCAACTGCCATCAGAGCAAGCTATCGACGCCTCTCGTCCGCTGACT
TGCGATGAGCTCGTGGACATGTGTCTCGAGGCTTCGTTGTCTGTCGCAAGGAACGATCCAATCAGAACGAACTTGTTCCTCATGGCGCTGGAAGCCGTAG
AGAGCATGCAGGACACGGACTCAGGCGAGTTTGACGTGGCGCTCGCGAGAGTGTGGCACCACTGCCTCTGCGAGGACGAGGAGCTCTGGGAGAGCCTGCT
GCAGGAGTACGCGTCGGGCGTGAACGAGCAGAAGCTGGAGCTGTTGATGCGCGAGACGCTGCTTTACTCTGCGATGACGCACCGCCAGCTGTTTGCCAAG
ACGCTCAGCTTTGCGATGACGCACTAG
	
	
MFRARKFVEVPSKRSGGLLSPPHPDLLVATGGTATTTTESKRQRLQLEAAESFFSNNQQPQMMMAPAATVSMDGGRDDATENVLIETPECTITMVDTLPS
FISDDIRKENGGHKQQQFPQIVSCRASIPSARHSSGRQWIVYFVVVLRTKILLWQEEQGKVISLSLPDELEDREVLNPFLFALYGQSLSLMVIGKSGIVL
FWEDIDLPYESVPLSVQIPLQYEEEVFTNADAIMSTVDQQEISQLQQSPEEDLKSIVCWSNQGNIWEVAMEDRRIRVRAFEKRNGGFLSGLTKSVSQFFF
ASASRSSSGQYGGELDPNLPIKYVKVVPSVADGIVSDETADMLVLFSNGIVERRTFSTGDVMDCSCVSVKHFDATRVAISYFSDNFPDQHLAKVEIVSLP
YVLDNCFALLVAFVCSTRQEASAKVKYAVFQFSLGSTSESPEPEWACVLDYEPSFSEVGDTSRYFHVDCFGVARGAFYLVWTKALPIQFASILLPRSGQT
TVRYAAFSLQGVHNRTAVGFGARLEANAFAGDAIKGSVSFVLMEDDNKLPHGGTVCVATASNMQKVEALPAQSASRGAASTSLHEKSRKRLEEASRLTGE
SPHFLAENLDVQEYVRLLTTHFHDDPYSTSPLRIANKDAFAVAQAAIAIDFQILDAKPSSGLRWGKEDTEGSTSHQTKKNGSNPALVTPKLVRFQLEEKR
TRHVEFLDFLQRRCANVWQVIVKSPELSRYLTEDEEKLNAAISLSKFQGSLHTQKPTEDPLSSTSSSGSIQRRLTGQFLLHAIEKTVEQRGYQKEQLRLA
GYNAFDIFYCEVSKITELFQLLSMEVQKLGTSIGESDPTYLYALLEAGYSMLSMLKPSSVSSESQASSGGAFTATGSWAFTRQVREVIVDQVSRLTVLVG
YSTLSGEKRIRWENDEIFEVTDQIKSLGCVLLDGYLRFLPALQGEEAEDLRKESELSKRYVLNPLVYVATNTALDTDRAGDFEQDGFLERKRNELFAQCV
KLSEKYAYYEGMVFLVYTEDQANLSKLDYVLGKLPKSASTKRLETYCKAYDGFAQFLFSWYGGEVRNPWPVSAVYERKARSTMLAYMLSNSKLYGGSLHQ
YMKGHETLSKNCWMTAISIERYDQTASLALHEAEHERSSLSKRKNLTSLAKIAALAAPDTSRNEENMQQIKRELVRIKIQEVLQQQLPSEQAIDASRPLT
CDELVDMCLEASLSVARNDPIRTNLFLMALEAVESMQDTDSGEFDVALARVWHHCLCEDEELWESLLQEYASGVNEQKLELLMRETLLYSAMTHRQLFAK
TLSFAMTH_