Scaffold : Scaffold_1
Gene_id : Pytve_DAOMBR484snap_masked-pve_contig_1-abinit-gene-0.99
Description : Histone transcription regulator HIRA
ATGTCGGATGCGCTGGTGCAGCGAAATGTTACTCGCTCGCACCTGGAGCACCAGATTGCTGCAGCGATAGCATTGAAGAGTTCGGCAGAGTACCGCTACT
GGTGAGAAGCACGCTGAAATTGTTGTCGTCGCATTGGATCTGCTGTTGACGTTCGGCGCATTATTTGTGGACTGGCAGGATTGAAGCGTATGTCAAATTT
CTCGCGCAAGACGAGGATGTATCTCGGTTGGACGGCCTATGCGCCGAGATGATGGGACCCTTTCACGCGTACGTTGGTTGTCTTTATCATTTCATGTTGC
CGTCTCAGCACGTCGGATCGTGGACTAACAATGGTGGGATGAAGCCCGAGCATTTCAGATGACGTTGCAGCCAAAGCTACCTCATCTAGCGACAATGACA
GTCTCTGGGACTCAATGGTGTTGGTAAGTACCTTGTTTTGTGCAGTGATAGACGATTCAATTGGCTCTAACGTGCTCATTGGCAACGGGCAGGATATGTC
AAAGCGCGAAGTGCTGAAAACGCACATTCTCCCAACGATGGCGGCAAATCGCAGCTTACAGCGGGTTGTGACGAAGTTCCAGCTCATGCTAAGCGAGATC
GACGAGCGCGAAAAGGTTGCCGCGGACGAATCCTG
	
	
ATGTCGGATGCGCTGGTGCAGCGAAATGTTACTCGCTCGCACCTGGAGCACCAGATTGCTGCAGCGATAGCATTGAAGAGTTCGGCAGAGTACCGCTACT
GGATTGAAGCGTATGTCAAATTTCTCGCGCAAGACGAGGATGATATGTCAAAGCGCGAAGTGCTGAAAACGCACATTCTCCCAACGATGGCGGCAAATCG
CAGCTTACAGCGGGTTGTGACGAAGTTCCAGCTCATGCTAAGCGAGATCGACGAGCGCGAAAAGGTTGCCGCGGACGAATCCTGA
	
	
MSDALVQRNVTRSHLEHQIAAAIALKSSAEYRYWIEAYVKFLAQDEDDMSKREVLKTHILPTMAANRSLQRVVTKFQLMLSEIDEREKVAADES_