Scaffold : Scaffold_849
Gene_id : Pytiw_DAOMBR242034maker-piw_contig_849-snap-gene-0.11
Description : Conserved gene of unknown function
ATGAGCAACCTCGCGGTCGTGGTGTCGAAGCAGCGGTCGGCCGAGACGTTTGCAGAGGTGTGCAAGATCCAGCACCTGCTCGCCAAGGACTTTGAGCGCC
ACGACGGCCGCCAGGAGCTCTTCAAGCTGCAGTTCCTGCGCGAGACGCGCAAACACCATCAGTGCATCTGCGAGGCAGCGTGTGCGGCGACCAGTTCAAT
GTCTGCCGCTGCGGCGTCCGCACTGCTGCTGGCGCAGCACGACGTGTTGTCAATGAACCGCGGCGGCGGATCTACAGCGAACGACCCAACGCTCGAGCAA
AGCAGCAGCGACACGGAAGCCGAGCGGAGGGTTAAAGCTCAGCTCAAGCAGCTACGCTCGTCCAGCGAGTCGAGCCAGACGCACATCTGGAACGGACTCA
AGAACCTGTACACCCCGCCAGACGTGACGACAGGGGTCATCTGCGACGTGTGCTTTGCCTTCAGGAGCGCGTCGCTCGTACTTGATTTGCCATCTCCATG
GCAGGAGTTCACATGTGAGAACGAGCCAAGCAAACACTATTATTACCACCCACAGACCAGGAAGGTACTCTGGCGCCCGCCGGTCGACACGGGCGTGCTT
AGTCTGCTCGTCTTCGAACGCACCAACTCAGTGTTCACTGTGTGCCACTGCAAGCCCTCGCGCGAGCGCCGACGCCGGCTGATGCAGAATTTCCGAGACC
ACGCGCTGCAGACCGCGGCCGCCGAGAGCGCGAAGAGAGATCGACAGCTACGTGGGGCCTTCAGCTCACTCGCGATCTCCATACTCAAGATAAAGCCCCA
GTA
	
	
ATGAGCAACCTCGCGGTCGTGGTGTCGAAGCAGCGGTCGGCCGAGACGTTTGCAGAGGTGTGCAAGATCCAGCACCTGCTCGCCAAGGACTTTGAGCGCC
ACGACGGCCGCCAGGAGCTCTTCAAGCTGCAGTTCCTGCGCGAGACGCGCAAACACCATCAGTGCATCTGCGAGGCAGCGTGTGCGGCGACCAGTTCAAT
GTCTGCCGCTGCGGCGTCCGCACTGCTGCTGGCGCAGCACGACGTGTTGTCAATGAACCGCGGCGGCGGATCTACAGCGAACGACCCAACGCTCGAGCAA
AGCAGCAGCGACACGGAAGCCGAGCGGAGGGTTAAAGCTCAGCTCAAGCAGCTACGCTCGTCCAGCGAGTCGAGCCAGACGCACATCTGGAACGGACTCA
AGAACCTGTACACCCCGCCAGACGTGACGACAGGGGTCATCTGCGACGTGTGCTTTGCCTTCAGGAGCGCGTCGCTCGTACTTGATTTGCCATCTCCATG
GCAGGAGTTCACATGTGAGAACGAGCCAAGCAAACACTATTATTACCACCCACAGACCAGGAAGGTACTCTGGCGCCCGCCGGTCGACACGGGCGTGCTT
AGTCTGCTCGTCTTCGAACGCACCAACTCAGTGTTCACTGTGTGCCACTGCAAGCCCTCGCGCGAGCGCCGACGCCGGCTGATGCAGAATTTCCGAGACC
ACGCGCTGCAGACCGCGGCCGCCGAGAGCGCGAAGAGAGATCGACAGCTACGTGGGGCCTTCAGCTCACTCGCGATCTCCATACTCAAGATAAAGCCCCA
GTAA
	
	
MSNLAVVVSKQRSAETFAEVCKIQHLLAKDFERHDGRQELFKLQFLRETRKHHQCICEAACAATSSMSAAAASALLLAQHDVLSMNRGGGSTANDPTLEQ
SSSDTEAERRVKAQLKQLRSSSESSQTHIWNGLKNLYTPPDVTTGVICDVCFAFRSASLVLDLPSPWQEFTCENEPSKHYYYHPQTRKVLWRPPVDTGVL
SLLVFERTNSVFTVCHCKPSRERRRRLMQNFRDHALQTAAAESAKRDRQLRGAFSSLAISILKIKPQ_