Scaffold : Scaffold_1
Gene_id : Pytar_ATCC12531maker-par_contig_1-fgenesh-gene-0.19
Description : Conserved gene of unknown function
ATGACCGAGCGCGTGCTGCAGCTGCTCGCGCGGCCGTGCGTGCTGGACGCGCTGCAGCGAGACGACGCGCTCGAGACGCTCAACGACATCTCGCCGCTCT
CGGACCACTACATCCCGACGCTGCAGTACCTCGTGCGGCCCGACAACCGTTCGTATTGCACCCTCAGTTCATTGCTTATTCGTGGCTCATATCCTTCTTC
TGTGGTTGGCAGTCATCGCGCTCGTATTCAGCATGCTTGAGGAGCCCCCTCCCCAGGTGAACGAACCGCGACGCCACCGATTTGAGATCTCTGAGCCGTC
ATACGACGAGTACGCGATCGTGTTTCGCGCCCACTGGGTGCTGTGCTCGTCCAGCTTTTCGTCGCAACTCGTCTCGGCGATCGTCGGGCTTCGGCCGCTC
GAAGGATCCACCAATGCTCCGTACCACTCACTCTGCGAACGCCTCGCGACGTATTATTCACGCGACGCCATGAACCTGGAAGCGCTCTCGCGGTTCCTAA
ACTTGTTCATGGATCAGTACTCACCAGAAGCCCTCATCGGGTTCCTGGGACCCATTTACGAGGTACGTTTCGTGCGGTCGCTGCTCGTGCTGATCCACTA
CGAGCCGATCCGCGATGTGCTCTTGCGGCTCTGCAATGAAATGGCCAACACGTGCGCTCCAATGCGTGCCATCACGACCCAGTTACTATGTCAACTCGCG
CCCGAGCGAGTGGTCAAAGAGTCCGTAGACGATGACGAGGTCCTCTCGCACATCCAACACGACCCGCCTCACGTCCAGTTCTCGCGCATGATCTTCACGT
GCGATTTGCTCACGGATCTGATCCACGAAAAGCGACACGGGACGTTGGGCCACCACGTGATCCACGAACTGCACTCGAGCGAGAACCACATTGCACACTT
GCTGGACGCGACCGTGCGCGATCTCGCGACGCTGCCCACGCAGCTCGCCAATGAATCGTACGTCATCAAGGTGCTAAACTCACTACTTCAACAAGCGCAG
TGCGGCTGCGTCTCCAAGATTGCCTTCTCGGCGGTGTTTGCACGCCACGCGGAGGCCACCAATGGTGGTGCGTCGGTCGACGACGCACTGCTGAGTCCAC
ACGTAGATCTCCCACTTATCTGGAAGCGCTTCATAGAACGTCTTCCTGACCTGCTGCGGTTCCTCGCGATTGCTCCAGCCCACCGATATCGCAGTGCCCA
CGTGCAGATGATCTACCTGATGCTGCCCATCTTGAACGTGTCGTGTTCCGCCGTGGACCGCCATCTCATCGCCCACAAGACCATGGAGGCGCTGCTGGAT
TTACTCATTCGGTTCCCGCAGGCCAACATCTTGCACTGCGCCATCTCGCGGCTCTTCATCGTGGCGCTCGAGGACTCGCCGTTCATGTTTGGCAAAGAAC
TGCCGGCCTTTCGTGCGGCCAACGATCCCCTGCGGCTCCACATGCTGCTGAACGGCTGCTTTGACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAGTGGCGGACGGACGCCGAGTGCCGTCGCCGCCGCCCGCGTTTGTGGACATTGCCATCTCGTTTGATCAGGCGGTCACCAACGCCCACGCGCACT
CACCGCAGCTCTTCGAACGCTCGACCATGGAGCGTTGGCACGCGTTCCGCTCGCAAGTCTTACTCCCAACGCAGGCCCAGTGGGAGGAGCAGCAAGGACA
GGTGATCGCCGCGGCAAGCCCCTCCAAAGTCCAGGCTTTTGTGGACGGCGTCAACGAGCTCTTTGATCCGAGCGAAGGGATCATGGTCATGCCAGTGCCC
GAGTCGCTGCTGCCGGCCATCGAGCCAACCGCTAGCGTTACTACTAAATCCGTTGACGATGTGTCGGCACCGGAACTACCAGGAGCGATCACTCCACTGA
ATGGAGGAGACGAGTTGTTCTCGACGCCGCTGTCGGCGCTGTACAATGACGAGGAAAAGCACATCATGCTTCGCGTCGCCAGCGATAAACCCGTGACCGC
GTCCAGGACTGCGTCCTTTGTGGCGAAACAACCCTTTGGCGGTGGATTTGTCGTAGACTA
	
	
ATGACCGAGCGCGTGCTGCAGCTGCTCGCGCGGCCGTGCGTGCTGGACGCGCTGCAGCGAGACGACGCGCTCGAGACGCTCAACGACATCTCGCCGCTCT
CGGACCACTACATCCCGACGCTGCAGTACCTCGTGCGGCCCGACAACCTCATCGCGCTCGTATTCAGCATGCTTGAGGAGCCCCCTCCCCAGGTGAACGA
ACCGCGACGCCACCGATTTGAGATCTCTGAGCCGTCATACGACGAGTACGCGATCGTGTTTCGCGCCCACTGGGTGCTGTGCTCGTCCAGCTTTTCGTCG
CAACTCGTCTCGGCGATCGTCGGGCTTCGGCCGCTCGAAGGATCCACCAATGCTCCGTACCACTCACTCTGCGAACGCCTCGCGACGTATTATTCACGCG
ACGCCATGAACCTGGAAGCGCTCTCGCGGTTCCTAAACTTGTTCATGGATCAGTACTCACCAGAAGCCCTCATCGGGTTCCTGGGACCCATTTACGAGGT
ACGTTTCGTGCGGTCGCTGCTCGTGCTGATCCACTACGAGCCGATCCGCGATGTGCTCTTGCGGCTCTGCAATGAAATGGCCAACACGTGCGCTCCAATG
CGTGCCATCACGACCCAGTTACTATGTCAACTCGCGCCCGAGCGAGTGGTCAAAGAGTCCGTAGACGATGACGAGGTCCTCTCGCACATCCAACACGACC
CGCCTCACGTCCAGTTCTCGCGCATGATCTTCACGTGCGATTTGCTCACGGATCTGATCCACGAAAAGCGACACGGGACGTTGGGCCACCACGTGATCCA
CGAACTGCACTCGAGCGAGAACCACATTGCACACTTGCTGGACGCGACCGTGCGCGATCTCGCGACGCTGCCCACGCAGCTCGCCAATGAATCGTACGTC
ATCAAGGTGCTAAACTCACTACTTCAACAAGCGCAGTGCGGCTGCGTCTCCAAGATTGCCTTCTCGGCGGTGTTTGCACGCCACGCGGAGGCCACCAATG
GTGGTGCGTCGGTCGACGACGCACTGCTGAGTCCACACGTAGATCTCCCACTTATCTGGAAGCGCTTCATAGAACGTCTTCCTGACCTGCTGCGGTTCCT
CGCGATTGCTCCAGCCCACCGATATCGCAGTGCCCACGTGCAGATGATCTACCTGATGCTGCCCATCTTGAACGTGTCGTGTTCCGCCGTGGACCGCCAT
CTCATCGCCCACAAGACCATGGAGGCGCTGCTGGATTTACTCATTCGGTTCCCGCAGGCCAACATCTTGCACTGCGCCATCTCGCGGCTCTTCATCGTGG
CGCTCGAGGACTCGCCGTTCATGTTTGGCAAAGAACTGCCGGCCTTTCTGGCGGACGGACGCCGAGTGCCGTCGCCGCCGCCCGCGTTTGTGGACATTGC
CATCTCGTTTGATCAGGCGGTCACCAACGCCCACGCGCACTCACCGCAGCTCTTCGAACGCTCGACCATGGAGCGTTGGCACGCGTTCCGCTCGCAAGTC
TTACTCCCAACGCAGGCCCAGTGGGAGGAGCAGCAAGGACAGGTGATCGCCGCGGCAAGCCCCTCCAAAGTCCAGGCTTTTGTGGACGGCGTCAACGAGC
TCTTTGATCCGAGCGAAGGGATCATGGTCATGCCAGTGCCCGAGTCGCTGCTGCCGGCCATCGAGCCAACCGCTAGCGTTACTACTAAATCCGTTGACGA
TGTGTCGGCACCGGAACTACCAGGAGCGATCACTCCACTGAATGGAGGAGACGAGTTGTTCTCGACGCCGCTGTCGGCGCTGTACAATGACGAGGAAAAG
CACATCATGCTTCGCGTCGCCAGCGATAAACCCGTGACCGCGTCCAGGACTGCGTCCTTTGTGGCGAAACAACCCTTTGGCGGTGGATTTGTCGTAGACT
AA
	
	
MTERVLQLLARPCVLDALQRDDALETLNDISPLSDHYIPTLQYLVRPDNLIALVFSMLEEPPPQVNEPRRHRFEISEPSYDEYAIVFRAHWVLCSSSFSS
QLVSAIVGLRPLEGSTNAPYHSLCERLATYYSRDAMNLEALSRFLNLFMDQYSPEALIGFLGPIYEVRFVRSLLVLIHYEPIRDVLLRLCNEMANTCAPM
RAITTQLLCQLAPERVVKESVDDDEVLSHIQHDPPHVQFSRMIFTCDLLTDLIHEKRHGTLGHHVIHELHSSENHIAHLLDATVRDLATLPTQLANESYV
IKVLNSLLQQAQCGCVSKIAFSAVFARHAEATNGGASVDDALLSPHVDLPLIWKRFIERLPDLLRFLAIAPAHRYRSAHVQMIYLMLPILNVSCSAVDRH
LIAHKTMEALLDLLIRFPQANILHCAISRLFIVALEDSPFMFGKELPAFLADGRRVPSPPPAFVDIAISFDQAVTNAHAHSPQLFERSTMERWHAFRSQV
LLPTQAQWEEQQGQVIAAASPSKVQAFVDGVNELFDPSEGIMVMPVPESLLPAIEPTASVTTKSVDDVSAPELPGAITPLNGGDELFSTPLSALYNDEEK
HIMLRVASDKPVTASRTASFVAKQPFGGGFVVD_