Scaffold : scaffold_30
Gene_id : Plaha_PHALS_07338
Description : FtsJ-like RNA methyltransferase
ATGAGTGAAAATGAAGAGTTGATTGCGAACATCGGGATCACGTCTTTTGGTCGAGTAAATCGTCGTATGAACCACAGAAAAATCAACAAACTTCCACAAA
TTCTACCTGGCACAGAGCTGGTAGTCAAACTAGCTGATCTTCCGATCAATAGCGTTGAAGTGGGACGTTATGGTCTATTATCGCTTTTGTACCAGAGCAA
AGGGTTTGATGCACTCGAAATTGCGCTTGATCGTACAAAAGACATTATTCATGAGGTTGGCGAGATAAGAAAACAATTGATTGACTTGACATTGCTCCAA
GAACTCAAGCaggaaaaagaaaaattcgACGAGTTAGTGAGCTCTGAGTTCCTCACCGCTCGCACTGCAACGAATCAGTTCGAGTCACTGGGAAGATACC
ATTTTATAAACCGCTCTGCAATGAAACTAGCCAATTTAGATTATATCTTTCAATGGACGTACAGTCTAAAAGAACGTGGTGACAAATTTAGCTTTGCAGA
CATTTGTGGCGGACCAGGTGGGTTTTCCGAATATTTATTGTGGAAAATGGATCAAATCGCTATAGAAGGtcatggctatggcatcacACTGAAAGATGCA
GCCAATGATTGCGATTGGCGCCTGCCTACCAGATTTCGTAAGTCAATGACAATTTGTTACGGCGAGGACGGAACGGGTAATTTGTACTCGATTGCAAACG
TTCACAGCTTTCGTGATTGTGTACGAAGGCAGCATCCCGATGGCGTTGACCTGGCTGTAGCTGATGGAGGATTTCCTGATGCTCGATCACAATTGAATCA
GGTGGGAGCGCACTTCTTTCGTGATGAAATGAAATGGATTTGGTAATCTTTCTGTCGTGTAGGAATCCATAATGACTCGATTAATTTTGGCAGAGGTTCT
TGCAATGTTTGCTGCACTTCGAATCGGCGGGGATTTCATCTGTAAGACATTTGAGTTGGTAACACCAGCTATGATAGAGATCTGTTGGATTTTGCATCAA
TCTTTCAAATGCTTTGCAGTTGTAAAGCCCATCGTACGTGCCACTGTTATCGCAAACTTCTGGCAGAAAATTAATTTGTATGTTGTACTAGACTTGCCGC
CCTGCCAGTTCCGAGCGCTATCTTGTCGCACGAGGTTTGCGTGCTGGTTTACCTACATCCAAACTTGTAGCAGTTTTAGAAGATCGACTCACAAACAGTT
ACAGCGAAACAAAATTTGACTTCAAACTACGCTTTTTGCACAACAATACATCGCTAAGTAACGACGATAACTTCCTGCAGTACTTGATGGCAGCAAATGA
TGTTATTGGCACGAGCCAACTCCACGCTTGTCGATGCATCAATGAATTTGCTGCCAACCCCGGAAAGAGAAAAGCACAAAACAAAGAAGTTACTGTTGAT
CCAAGACAATACTACCGATGTTGGCAACTTCGCAGTAATAGTCCGCGCAAGACTCAAATATA
	
	
ATGAGTGAAAATGAAGAGTTGATTGCGAACATCGGGATCACGTCTTTTGGTCGAGTAAATCGTCGTATGAACCACAGAAAAATCAACAAACTTCCACAAA
TTCTACCTGGCACAGAGCTGGTAGTCAAACTAGCTGATCTTCCGATCAATAGCGTTGAAGTGGGACGTTATGGTCTATTATCGCTTTTGTACCAGAGCAA
AGGGTTTGATGCACTCGAAATTGCGCTTGATCGTACAAAAGACATTATTCATGAGGTTGGCGAGATAAGAAAACAATTGATTGACTTGACATTGCTCCAA
GAACTCAAGCaggaaaaagaaaaattcgACGAGTTAGTGAGCTCTGAGTTCCTCACCGCTCGCACTGCAACGAATCAGTTCGAGTCACTGGGAAGATACC
ATTTTATAAACCGCTCTGCAATGAAACTAGCCAATTTAGATTATATCTTTCAATGGACGTACAGTCTAAAAGAACGTGGTGACAAATTTAGCTTTGCAGA
CATTTGTGGCGGACCAGGTGGGTTTTCCGAATATTTATTGTGGAAAATGGATCAAATCGCTATAGAAGGtcatggctatggcatcacACTGAAAGATGCA
GCCAATGATTGCGATTGGCGCCTGCCTACCAGATTTCGTAAGTCAATGACAATTTGTTACGGCGAGGACGGAACGGGTAATTTGTACTCGATTGCAAACG
TTCACAGCTTTCGTGATTGTGTACGAAGGCAGCATCCCGATGGCGTTGACCTGGCTGTAGCTGATGGAGGATTTCCTGATGCTCGATCACAATTGAATCA
GGAATCCATAATGACTCGATTAATTTTGGCAGAGGTTCTTGCAATGTTTGCTGCACTTCGAATCGGCGGGGATTTCATCTGTAAGACATTTGAGTTGGTA
ACACCAGCTATGATAGAGATCTGTTGGATTTTGCATCAATCTTTCAAATGCTTTGCAGTTGTAAAGCCCATCACTTGCCGCCCTGCCAGTTCCGAGCGCT
ATCTTGTCGCACGAGGTTTGCGTGCTGGTTTACCTACATCCAAACTTGTAGCAGTTTTAGAAGATCGACTCACAAACAGTTACAGCGAAACAAAATTTGA
CTTCAAACTACGCTTTTTGCACAACAATACATCGCTAAGTAACGACGATAACTTCCTGCAGTACTTGATGGCAGCAAATGATGTTATTGGCACGAGCCAA
CTCCACGCTTGTCGATGCATCAATGAATTTGCTGCCAACCCCGGAAAGAGAAAAGCACAAAACAAAGAAGTTACTGTTGATCCAAGACAATACTACCGAT
GTTGGCAACTTCGCAGTAATAGTCCGCGCAAGACTCAAATATAA
	
	
MSENEELIANIGITSFGRVNRRMNHRKINKLPQILPGTELVVKLADLPINSVEVGRYGLLSLLYQSKGFDALEIALDRTKDIIHEVGEIRKQLIDLTLLQ
ELKQEKEKFDELVSSEFLTARTATNQFESLGRYHFINRSAMKLANLDYIFQWTYSLKERGDKFSFADICGGPGGFSEYLLWKMDQIAIEGHGYGITLKDA
ANDCDWRLPTRFRKSMTICYGEDGTGNLYSIANVHSFRDCVRRQHPDGVDLAVADGGFPDARSQLNQESIMTRLILAEVLAMFAALRIGGDFICKTFELV
TPAMIEICWILHQSFKCFAVVKPITCRPASSERYLVARGLRAGLPTSKLVAVLEDRLTNSYSETKFDFKLRFLHNNTSLSNDDNFLQYLMAANDVIGTSQ
LHACRCINEFAANPGKRKAQNKEVTVDPRQYYRCWQLRSNSPRKTQI_