Description :
tRNA
Sequence
72 bases(100 bases per row)
GCTCCTTTGGATCAATTGGTAGAGCATCAGTTTCGAATTCTGAAGGTCACCAGTTCGATCCGGGCAGGGAGC