Description :
Transposon
Attribute :
helitronORF 1010 1095
Sequence
293 bases(100 bases per row)
GGCGGCGTTGTCGATGAGCATGCCACGTGGAATCTTAATGTAGTCATTTCCCAGATCATTGTGTACCTCGTGTCTCCCCTCCCCAACCTTCAGCAGGTAC
TCGGAACACGCAGCCATTTTTGCAGCACTATCGGACGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGATGCACCTTTTGGAAAAGTGGCCACCGTT
CGGATGACTTCAGGCATGCGTCAATTGTCTCTGTAGCCGAGCCGCCCTTCACCACCTGGAGAATTTGCCTAGAATCTCTCTGAAACTCGACCA