Description :
Transposon
Attribute :
helitronORF 1264 1321
Sequence
188 bases(100 bases per row)
GAACAGGTGGCGGTACACTATGGTCGCCGTGTACACTCCGTCTGCTTCCTCCCGCTCTGGATACTCGACCAATGCCTTGCATCTCGATCTCGACGTAACC
CTTGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACAGTTTGTCCCTGCACCT