Description :
repeat
Sequence
29 bases(100 bases per row)
ACGGACGGACTGACGGACGGACGGACAGA