Description :
repeat
Sequence
26 bases(100 bases per row)
TGCACGCTTTGCAGCTATGCACGCTA