Description :
repeat
Sequence
30 bases(100 bases per row)
AAGAAGAACAAGAAGAAAAAGAAAACAAGA