Description :
repeat
Sequence
37 bases(100 bases per row)
CAAGAGAAGAAGAACAAGAAGAAAAAGAAAACAAGAA