Description :
repeat
Sequence
54 bases(100 bases per row)
CTCTTAGAAAACAATGGCTTACAGCAGTCTCTTAGAAAACAATGGTTACAGCAG