Description :
repeat
Sequence
319 bases(100 bases per row)
TGTAACGGGTACGTAGCCCTAAGTGTACCCCTACTTACATGAAGTGTAACACGTCATACTTCGGGATATTTGGTACAAGGTACCAAGGTCGTCCAAAGCC
AACCATTGGCTAATGACATTGCTTTTCTGTAGGTGACTTATAGTTTGTATTGAATTCAAGCTTAGCCTACCTATAAAATATACTTAGCTTACCATCTACC
TTAAATTGGTCACTTCGCTCCCTTTCGGTAAAAGGGGACCTGTGAACTGCCGCTCACTGAGAGTTTGTATACTCTCGGAAGCCAACTTTCTCTAGCGCAA
GGTGCTGTGTGACCCCGTC