Description :
repeat
Sequence
21 bases(100 bases per row)
GATATGCAGGATATGCAGGAT