Description :
repeat
Sequence
2464 bases(100 bases per row)
TGGCGAAGCCTTTAAGGCAGGCGAGCTAGCCGAGGTGGTCCTGCTGGGACCTGAGGAGGAGTTGAACTCATCATCCGTCGTGGACGACGTGGTCCTAGAG
GACACCAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCTTCAAAGATTCTTTGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCT
CGAATGACCCACCGACGGGCCTGCCTCCAGATCGAGGCGTGTGTCATGAAATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTT
GCCGAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCATGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGTTC
TGTGGCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATG
TTCTGCAGAACAACATGGTAGGCTGTACGTTGTACAGTGGGCTCGACTTGGTCGATGGTTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGAC
AGCGGTGAGTACTCCGAGCGGTATGCTCTGTGAGTGGCTGGTCATGCCCCACGGGCTGTCGAGCGCACCAGAAACGTTCAATCGTCTTGTGACGCAGTTG
TTTAGGCCCCACCGGGCGTACGCTCAGACGTACTTTGACGGTATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGTTAACCACATTGACC
ACTTGCGAGCGGTGCTCGAGTGCATGCACACTAATAAATTGTATGTCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTT
CATTGGGAAGCGTGGCTTAAGGGCAGATCCTGCCGAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAAGACTTGCGCAAGTGGCTAGG
CTTAGCCAATTACTTGCATGAGTACAGCGCGAACTACGCGGAGATAGCTCGGCCATTATCAGATCTCCTTACGAAGGACGCACCATGGTGCTGGAACGTC
GAGCTCGACAGAGCCTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGACTCCGATCCTTGCGCTACCGGACCCGGATATTCCGTTTAGCATCGTCTATGACG
CCTCTGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGACGGGCGTGAACGCGTGATTGCGTTTGAGTCTGGCCAGCTCAAAGCTGCAGAGAA
GAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGACGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCCTTTGTGATCTTTACT
GATCATGCGTCGCTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCATTGCCGAGTATAACTTCGAGGTGAAGT
ACAAGCCGGGACGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAATTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTT
GATACGCAGAGCGTATGCACAGGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTTACAAAGAATTGTCTGGGCGC
TTACGCGCGAGGCTGCATCGATACTCGCTCGATGGTGGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCCTCGTGTAGTCGTTCCTCATTTTAAGT
TTCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTATGTCGGGAGAAGACCTATGGCTTGGTGAGCTCGATGTGCTGGTAGCCCAAGAT
GTATAAGTGGGTTGGCACCTATGTACGCACGTGTGAGACGTGTCAGCGGACAAAGTCCGCGCCGATCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCC
AAGGGATGCTGGCAGTCCATGAGTATGGACTTTGTTTTTGGCCTTTCCAAGGATAAGGCGGAAAACACGGGTATAGTGGTCTTTGTAGACCGATTGAGCA
AGATGGCTCATTTAGCGGCAGTGCCGGACCCCTTTGATGGTGAAGGTACCGCTTTGCTGCTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGAC
AATTGTCTCGGATCGAGACCCGCGCTTCACCGCAAAGTTCTGGACGTTCCTCTTCAGAGTGCTCGGCAATCGTTTGGACATGTCCACAGCGGACCATCCG
CAGACCGATGTTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCAC
TCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACGGGCTAAACTCCGTTCTATGTGAA