Description :
repeat
Sequence
27 bases(100 bases per row)
TGACGGGGTCACACAGCACCTTGCGCT