Description :
repeat
Sequence
44 bases(100 bases per row)
AATACAAATAAGCCCCTTGAATACAATTGACCCCCTGAATATAA